Incidental Mutation 'R5257:Sesn1'
ID399795
Institutional Source Beutler Lab
Gene Symbol Sesn1
Ensembl Gene ENSMUSG00000038332
Gene Namesestrin 1
SynonymsSEST1, 1110002G11Rik, PA26
MMRRC Submission 042855-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5257 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location41809935-41908424 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 41894988 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 172 (P172S)
Ref Sequence ENSEMBL: ENSMUSP00000097515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041438] [ENSMUST00000099931]
Predicted Effect probably benign
Transcript: ENSMUST00000041438
AA Change: P113S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000043034
Gene: ENSMUSG00000038332
AA Change: P113S

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:PA26 45 492 5.4e-227 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099931
AA Change: P172S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000097515
Gene: ENSMUSG00000038332
AA Change: P172S

DomainStartEndE-ValueType
Pfam:PA26 106 550 1.2e-212 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214835
Meta Mutation Damage Score 0.2411 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sestrin family. Sestrins are induced by the p53 tumor suppressor protein and play a role in the cellular response to DNA damage and oxidative stress. The encoded protein mediates p53 inhibition of cell growth by activating AMP-activated protein kinase, which results in the inhibition of the mammalian target of rapamycin protein. The encoded protein also plays a critical role in antioxidant defense by regenerating overoxidized peroxiredoxins, and the expression of this gene is a potential marker for exposure to radiation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a kncok-out allele exhibit enhanced responsiveness to an influenza vaccine in aged mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,249,684 T128S possibly damaging Het
Abca16 T G 7: 120,436,769 probably null Het
Acpp T C 9: 104,309,475 I266V probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Asf1b C T 8: 83,969,267 T179I probably benign Het
Astn1 A G 1: 158,612,532 K890R probably damaging Het
Card11 G A 5: 140,876,425 P1039L possibly damaging Het
Chsy3 A G 18: 59,409,794 E668G possibly damaging Het
Cnot8 T A 11: 58,117,522 N271K possibly damaging Het
Dcaf5 G T 12: 80,397,719 P200H probably damaging Het
Dkk4 C A 8: 22,627,015 L215I probably damaging Het
Dnhd1 C T 7: 105,674,037 T584I probably benign Het
Dock3 T C 9: 106,996,925 Y449C probably damaging Het
Dsg1a A G 18: 20,320,931 D31G probably damaging Het
Fgfr1op T C 17: 8,172,943 S152P probably benign Het
Foxi2 C T 7: 135,410,527 T48M probably benign Het
Gdf3 T C 6: 122,606,386 M341V probably damaging Het
Gm21738 A G 14: 19,415,942 L199S probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Igkv4-80 T A 6: 69,016,827 T27S probably benign Het
Ipo9 A T 1: 135,385,435 C1019S probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Ktn1 T A 14: 47,667,363 H199Q probably benign Het
Kyat3 A G 3: 142,734,576 M354V probably benign Het
Lbhd1 A G 19: 8,884,089 probably benign Het
Llgl1 G C 11: 60,711,563 probably null Het
Lyzl6 T A 11: 103,635,073 I74F probably damaging Het
Mfsd4b2 T A 10: 39,922,021 M113L probably benign Het
Mslnl T C 17: 25,746,165 Y502H probably benign Het
Nckap5 A G 1: 126,024,508 S1372P probably damaging Het
Nle1 T C 11: 82,904,946 D225G probably damaging Het
Olfr221 T C 14: 52,035,884 T76A possibly damaging Het
P2rx7 A G 5: 122,681,003 E496G probably damaging Het
Padi4 C T 4: 140,746,204 V641M probably benign Het
Phf11d T C 14: 59,352,711 I221V possibly damaging Het
Pla2g2c G A 4: 138,731,545 probably benign Het
Prdm16 A T 4: 154,367,214 D179E possibly damaging Het
Psca A T 15: 74,716,391 I56F probably damaging Het
Ptrhd1 A G 12: 4,236,481 Y124C probably damaging Het
Sardh T C 2: 27,244,259 T82A probably damaging Het
Setd4 T C 16: 93,596,333 T57A probably damaging Het
Skint5 T C 4: 113,577,662 T1037A unknown Het
Slc18a3 T C 14: 32,463,820 D202G probably damaging Het
Slc44a5 G A 3: 154,243,123 C176Y probably damaging Het
Slc6a5 G A 7: 49,929,992 V373M probably damaging Het
Sorbs3 T C 14: 70,185,034 I523V probably benign Het
Sspo T C 6: 48,476,494 V2872A probably damaging Het
Stard9 T A 2: 120,699,343 L2027H probably damaging Het
Tex2 T A 11: 106,567,759 probably benign Het
Tfdp1 C T 8: 13,369,529 T86M possibly damaging Het
Ttc6 A T 12: 57,702,275 D1331V possibly damaging Het
Vps13b A G 15: 35,794,421 T2326A possibly damaging Het
Wnk1 A G 6: 120,037,188 S149P probably benign Het
Zfp521 G A 18: 13,846,978 S126F probably damaging Het
Zfp958 A T 8: 4,628,456 E160D probably benign Het
Other mutations in Sesn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Sesn1 APN 10 41898325 missense probably damaging 1.00
IGL01766:Sesn1 APN 10 41898369 missense probably benign 0.00
R1103:Sesn1 UTSW 10 41902593 missense possibly damaging 0.94
R1557:Sesn1 UTSW 10 41903766 missense probably damaging 1.00
R1587:Sesn1 UTSW 10 41811112 missense probably benign
R2177:Sesn1 UTSW 10 41903782 missense possibly damaging 0.73
R2437:Sesn1 UTSW 10 41905319 missense probably damaging 1.00
R3915:Sesn1 UTSW 10 41894890 missense probably benign 0.13
R4965:Sesn1 UTSW 10 41895009 missense probably damaging 1.00
R5141:Sesn1 UTSW 10 41811101 missense probably benign
R5258:Sesn1 UTSW 10 41894988 missense probably benign 0.03
R5639:Sesn1 UTSW 10 41811271 missense probably benign
R5899:Sesn1 UTSW 10 41811193 missense probably benign
R6024:Sesn1 UTSW 10 41896200 missense probably damaging 0.99
R6310:Sesn1 UTSW 10 41896078 missense probably damaging 1.00
R7181:Sesn1 UTSW 10 41903728 missense possibly damaging 0.84
R7770:Sesn1 UTSW 10 41894058 missense probably damaging 1.00
R7909:Sesn1 UTSW 10 41811116 missense probably benign 0.03
R7990:Sesn1 UTSW 10 41811116 missense probably benign 0.03
R7996:Sesn1 UTSW 10 41894933 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTGTGTGCAACTGTGGCTC -3'
(R):5'- TGTCTCTGAAGCATGCGAGAG -3'

Sequencing Primer
(F):5'- GTGCAACTGTGGCTCTCCTC -3'
(R):5'- CGAGAGCGCATGCACAC -3'
Posted On2016-07-06