Incidental Mutation 'R5257:Nle1'
ID399802
Institutional Source Beutler Lab
Gene Symbol Nle1
Ensembl Gene ENSMUSG00000020692
Gene Namenotchless homolog 1
Synonymsnotchless, Nle, l11Jus4, l11Jus1
MMRRC Submission 042855-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5257 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location82900768-82908411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82904946 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 225 (D225G)
Ref Sequence ENSEMBL: ENSMUSP00000099502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018988] [ENSMUST00000103213]
Predicted Effect probably benign
Transcript: ENSMUST00000018988
SMART Domains Protein: ENSMUSP00000018988
Gene: ENSMUSG00000018844

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
FN3 176 264 9.48e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103213
AA Change: D225G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099502
Gene: ENSMUSG00000020692
AA Change: D225G

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:NLE 17 77 3.6e-15 PFAM
WD40 103 142 5.22e-12 SMART
WD40 145 184 1.48e-11 SMART
WD40 188 232 1.66e-5 SMART
WD40 235 273 3.11e-10 SMART
WD40 276 357 1.14e-3 SMART
WD40 361 400 8.81e-10 SMART
WD40 403 442 1.69e-11 SMART
WD40 445 484 9.44e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124109
Predicted Effect probably benign
Transcript: ENSMUST00000126202
SMART Domains Protein: ENSMUSP00000130605
Gene: ENSMUSG00000020692

DomainStartEndE-ValueType
SCOP:d1flga_ 12 46 2e-5 SMART
Blast:WD40 22 48 2e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147915
Predicted Effect probably benign
Transcript: ENSMUST00000167196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170815
Meta Mutation Damage Score 0.9640 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 97% (63/65)
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation, most blastocysts fail to hatch out of the zona pellucida, and apoptosis is increased in the inner cell mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,249,684 T128S possibly damaging Het
Abca16 T G 7: 120,436,769 probably null Het
Acpp T C 9: 104,309,475 I266V probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Asf1b C T 8: 83,969,267 T179I probably benign Het
Astn1 A G 1: 158,612,532 K890R probably damaging Het
Card11 G A 5: 140,876,425 P1039L possibly damaging Het
Chsy3 A G 18: 59,409,794 E668G possibly damaging Het
Cnot8 T A 11: 58,117,522 N271K possibly damaging Het
Dcaf5 G T 12: 80,397,719 P200H probably damaging Het
Dkk4 C A 8: 22,627,015 L215I probably damaging Het
Dnhd1 C T 7: 105,674,037 T584I probably benign Het
Dock3 T C 9: 106,996,925 Y449C probably damaging Het
Dsg1a A G 18: 20,320,931 D31G probably damaging Het
Fgfr1op T C 17: 8,172,943 S152P probably benign Het
Foxi2 C T 7: 135,410,527 T48M probably benign Het
Gdf3 T C 6: 122,606,386 M341V probably damaging Het
Gm21738 A G 14: 19,415,942 L199S probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Igkv4-80 T A 6: 69,016,827 T27S probably benign Het
Ipo9 A T 1: 135,385,435 C1019S probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Ktn1 T A 14: 47,667,363 H199Q probably benign Het
Kyat3 A G 3: 142,734,576 M354V probably benign Het
Lbhd1 A G 19: 8,884,089 probably benign Het
Llgl1 G C 11: 60,711,563 probably null Het
Lyzl6 T A 11: 103,635,073 I74F probably damaging Het
Mfsd4b2 T A 10: 39,922,021 M113L probably benign Het
Mslnl T C 17: 25,746,165 Y502H probably benign Het
Nckap5 A G 1: 126,024,508 S1372P probably damaging Het
Olfr221 T C 14: 52,035,884 T76A possibly damaging Het
P2rx7 A G 5: 122,681,003 E496G probably damaging Het
Padi4 C T 4: 140,746,204 V641M probably benign Het
Phf11d T C 14: 59,352,711 I221V possibly damaging Het
Pla2g2c G A 4: 138,731,545 probably benign Het
Prdm16 A T 4: 154,367,214 D179E possibly damaging Het
Psca A T 15: 74,716,391 I56F probably damaging Het
Ptrhd1 A G 12: 4,236,481 Y124C probably damaging Het
Sardh T C 2: 27,244,259 T82A probably damaging Het
Sesn1 C T 10: 41,894,988 P172S probably benign Het
Setd4 T C 16: 93,596,333 T57A probably damaging Het
Skint5 T C 4: 113,577,662 T1037A unknown Het
Slc18a3 T C 14: 32,463,820 D202G probably damaging Het
Slc44a5 G A 3: 154,243,123 C176Y probably damaging Het
Slc6a5 G A 7: 49,929,992 V373M probably damaging Het
Sorbs3 T C 14: 70,185,034 I523V probably benign Het
Sspo T C 6: 48,476,494 V2872A probably damaging Het
Stard9 T A 2: 120,699,343 L2027H probably damaging Het
Tex2 T A 11: 106,567,759 probably benign Het
Tfdp1 C T 8: 13,369,529 T86M possibly damaging Het
Ttc6 A T 12: 57,702,275 D1331V possibly damaging Het
Vps13b A G 15: 35,794,421 T2326A possibly damaging Het
Wnk1 A G 6: 120,037,188 S149P probably benign Het
Zfp521 G A 18: 13,846,978 S126F probably damaging Het
Zfp958 A T 8: 4,628,456 E160D probably benign Het
Other mutations in Nle1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02226:Nle1 APN 11 82904307 nonsense probably null
IGL02945:Nle1 APN 11 82904084 splice site probably benign
IGL03170:Nle1 APN 11 82904270 missense probably benign
R0401:Nle1 UTSW 11 82905379 unclassified probably benign
R0646:Nle1 UTSW 11 82904845 missense probably damaging 1.00
R1958:Nle1 UTSW 11 82904242 missense probably benign 0.01
R1966:Nle1 UTSW 11 82901788 missense probably damaging 1.00
R2016:Nle1 UTSW 11 82905547 missense probably damaging 1.00
R2017:Nle1 UTSW 11 82905547 missense probably damaging 1.00
R2049:Nle1 UTSW 11 82905366 missense probably damaging 1.00
R2140:Nle1 UTSW 11 82905568 missense probably damaging 0.99
R2289:Nle1 UTSW 11 82903053 missense probably benign 0.01
R4354:Nle1 UTSW 11 82906431 missense possibly damaging 0.65
R4963:Nle1 UTSW 11 82904937 missense probably benign 0.04
R4964:Nle1 UTSW 11 82908192 missense probably damaging 1.00
R5258:Nle1 UTSW 11 82904946 missense probably damaging 1.00
R5509:Nle1 UTSW 11 82903182 missense possibly damaging 0.92
R6160:Nle1 UTSW 11 82908157 missense probably benign 0.01
R7206:Nle1 UTSW 11 82904931 missense probably benign 0.35
R7696:Nle1 UTSW 11 82904966 nonsense probably null
Z1176:Nle1 UTSW 11 82904312 missense probably damaging 1.00
Z1177:Nle1 UTSW 11 82901843 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TCAGAATGCCCCTTACGTCATG -3'
(R):5'- TACTATGGCCACACCCCTTG -3'

Sequencing Primer
(F):5'- TGGGCCCTCCAGACTTTGATG -3'
(R):5'- GGCTCATCACATGACCTGAG -3'
Posted On2016-07-06