Incidental Mutation 'R5193:Fsip2'
ID 399805
Institutional Source Beutler Lab
Gene Symbol Fsip2
Ensembl Gene ENSMUSG00000075249
Gene Name fibrous sheath-interacting protein 2
Synonyms OTTMUSG00000013335
MMRRC Submission 042769-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.108) question?
Stock # R5193 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 82773978-82839281 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 82813338 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 3219 (Y3219F)
Ref Sequence ENSEMBL: ENSMUSP00000120314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143764]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000132967
AA Change: Y733F
SMART Domains Protein: ENSMUSP00000122350
Gene: ENSMUSG00000075249
AA Change: Y733F

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
low complexity region 79 90 N/A INTRINSIC
low complexity region 381 392 N/A INTRINSIC
low complexity region 411 430 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
low complexity region 953 962 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000143764
AA Change: Y3219F

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120314
Gene: ENSMUSG00000075249
AA Change: Y3219F

DomainStartEndE-ValueType
coiled coil region 271 297 N/A INTRINSIC
low complexity region 544 561 N/A INTRINSIC
low complexity region 586 597 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1115 1120 N/A INTRINSIC
low complexity region 1531 1545 N/A INTRINSIC
low complexity region 2044 2057 N/A INTRINSIC
low complexity region 2507 2523 N/A INTRINSIC
low complexity region 2564 2575 N/A INTRINSIC
low complexity region 2866 2877 N/A INTRINSIC
low complexity region 2896 2915 N/A INTRINSIC
low complexity region 3220 3231 N/A INTRINSIC
low complexity region 3438 3447 N/A INTRINSIC
Pfam:FSIP2 4045 4408 3.5e-42 PFAM
Pfam:FSIP2 4375 4613 7.7e-26 PFAM
Pfam:FSIP2 4622 4932 4.3e-17 PFAM
Pfam:FSIP2 4903 5454 7e-27 PFAM
low complexity region 5507 5522 N/A INTRINSIC
low complexity region 5769 5780 N/A INTRINSIC
low complexity region 5834 5846 N/A INTRINSIC
low complexity region 5851 5867 N/A INTRINSIC
Pfam:FSIP2 5998 6867 N/A PFAM
low complexity region 6977 6990 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the sperm fibrous sheath. Genes encoding most of the fibrous-sheath associated proteins genes are transcribed only during the postmeiotic period of spermatogenesis. The protein encoded by this gene is specific to spermatogenic cells. Copy number variation in this gene may be associated with testicular germ cell tumors. Pseudogenes associated with this gene are reported on chromosomes 2 and X. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 A T 2: 150,677,226 (GRCm39) *56R probably null Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Arfgap3 C T 15: 83,216,898 (GRCm39) A156T probably benign Het
Bpifc T C 10: 85,836,497 (GRCm39) T3A probably benign Het
Ccdc7a T A 8: 129,715,278 (GRCm39) I269L probably benign Het
Cd151 A G 7: 141,050,606 (GRCm39) Y253C probably damaging Het
Cenpl C A 1: 160,911,037 (GRCm39) S328* probably null Het
Cfl1 T A 19: 5,542,580 (GRCm39) V20D probably damaging Het
Clec14a A G 12: 58,315,400 (GRCm39) L74P probably damaging Het
Cnn1 A T 9: 22,019,132 (GRCm39) D196V probably damaging Het
Cst13 C A 2: 148,670,143 (GRCm39) C104* probably null Het
Det1 A G 7: 78,493,302 (GRCm39) V234A probably damaging Het
Efnb2 A G 8: 8,673,162 (GRCm39) M165T probably damaging Het
Fbxo10 T A 4: 45,051,573 (GRCm39) K339* probably null Het
Fnta A T 8: 26,501,246 (GRCm39) probably null Het
Gprin2 C T 14: 33,916,832 (GRCm39) V313M possibly damaging Het
Hars1 A G 18: 36,900,358 (GRCm39) L448S possibly damaging Het
Hipk3 A G 2: 104,260,345 (GRCm39) I1166T possibly damaging Het
Il31ra T C 13: 112,660,864 (GRCm39) E602G probably benign Het
Kctd15 A G 7: 34,344,282 (GRCm39) L123P probably damaging Het
Kifbp T C 10: 62,395,175 (GRCm39) D489G possibly damaging Het
Krt1 C A 15: 101,754,357 (GRCm39) S631I unknown Het
Lancl1 T A 1: 67,060,173 (GRCm39) Y84F probably benign Het
Lcor A G 19: 41,570,969 (GRCm39) D54G probably damaging Het
Mafa G T 15: 75,619,666 (GRCm39) P36T unknown Het
Magi2 G A 5: 20,563,970 (GRCm39) probably null Het
Mcm9 T A 10: 53,492,134 (GRCm39) I396F probably damaging Het
Mrgprh T C 17: 13,095,942 (GRCm39) F61L probably damaging Het
Or10g1b A G 14: 52,628,069 (GRCm39) W54R probably benign Het
Or1e16 TAGCGGTCGTA T 11: 73,286,479 (GRCm39) probably null Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or51a7 T A 7: 102,615,143 (GRCm39) F279I possibly damaging Het
Or5w17 A T 2: 87,583,448 (GRCm39) D296E possibly damaging Het
Pcsk5 T A 19: 17,542,174 (GRCm39) T806S possibly damaging Het
Pigc T C 1: 161,798,465 (GRCm39) I149T possibly damaging Het
Pou5f2 C A 13: 78,173,083 (GRCm39) N8K probably benign Het
Pou6f2 T C 13: 18,300,129 (GRCm39) probably benign Het
Prl3d2 T A 13: 27,306,312 (GRCm39) M13K possibly damaging Het
Pzp T C 6: 128,479,297 (GRCm39) N619D probably benign Het
Rnps1 G A 17: 24,637,517 (GRCm39) S53N probably benign Het
Scaf8 C G 17: 3,240,440 (GRCm39) A604G probably benign Het
Scn10a T C 9: 119,438,721 (GRCm39) N1716S probably damaging Het
Slc22a30 G A 19: 8,321,757 (GRCm39) Q436* probably null Het
Slc34a1 A G 13: 24,003,845 (GRCm39) probably null Het
Syne2 A G 12: 76,141,194 (GRCm39) D6102G probably damaging Het
Tbc1d16 A T 11: 119,049,646 (GRCm39) D283E probably benign Het
Tet1 T C 10: 62,674,026 (GRCm39) D1350G probably benign Het
Trpa1 A G 1: 14,946,141 (GRCm39) Y997H possibly damaging Het
Tyro3 T C 2: 119,640,998 (GRCm39) L494P probably damaging Het
Uba6 G T 5: 86,272,281 (GRCm39) Q803K probably benign Het
Vgll2 T A 10: 51,904,088 (GRCm39) L317Q possibly damaging Het
Wdr62 A T 7: 29,964,592 (GRCm39) I384N probably damaging Het
Wdtc1 G A 4: 133,021,678 (GRCm39) R619* probably null Het
Xkr6 A G 14: 64,056,356 (GRCm39) D89G possibly damaging Het
Other mutations in Fsip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Fsip2 APN 2 82,820,730 (GRCm39) missense probably benign 0.18
IGL00557:Fsip2 APN 2 82,821,657 (GRCm39) missense possibly damaging 0.53
IGL01343:Fsip2 APN 2 82,830,163 (GRCm39) missense possibly damaging 0.53
IGL01387:Fsip2 APN 2 82,823,326 (GRCm39) missense possibly damaging 0.71
IGL01523:Fsip2 APN 2 82,807,863 (GRCm39) missense probably benign
IGL01554:Fsip2 APN 2 82,807,622 (GRCm39) missense possibly damaging 0.68
IGL01650:Fsip2 APN 2 82,821,430 (GRCm39) missense probably benign 0.33
IGL01809:Fsip2 APN 2 82,808,691 (GRCm39) missense possibly damaging 0.80
IGL01826:Fsip2 APN 2 82,812,983 (GRCm39) missense probably benign 0.18
IGL01830:Fsip2 APN 2 82,815,273 (GRCm39) missense probably benign
IGL01918:Fsip2 APN 2 82,822,482 (GRCm39) missense possibly damaging 0.71
IGL01932:Fsip2 APN 2 82,824,349 (GRCm39) missense possibly damaging 0.71
IGL01989:Fsip2 APN 2 82,824,211 (GRCm39) missense probably damaging 0.99
IGL02096:Fsip2 APN 2 82,822,204 (GRCm39) missense possibly damaging 0.85
IGL02153:Fsip2 APN 2 82,809,065 (GRCm39) missense probably benign
IGL02155:Fsip2 APN 2 82,828,696 (GRCm39) missense probably benign
IGL02219:Fsip2 APN 2 82,808,174 (GRCm39) missense probably benign 0.07
IGL02248:Fsip2 APN 2 82,813,116 (GRCm39) missense possibly damaging 0.73
IGL02316:Fsip2 APN 2 82,809,137 (GRCm39) missense probably benign
IGL02478:Fsip2 APN 2 82,814,736 (GRCm39) missense probably benign 0.00
IGL02504:Fsip2 APN 2 82,809,199 (GRCm39) missense possibly damaging 0.83
IGL02572:Fsip2 APN 2 82,822,347 (GRCm39) missense probably benign 0.32
IGL02625:Fsip2 APN 2 82,779,836 (GRCm39) missense probably benign 0.00
IGL02665:Fsip2 APN 2 82,823,407 (GRCm39) missense probably damaging 1.00
IGL02668:Fsip2 APN 2 82,828,662 (GRCm39) missense probably benign 0.06
IGL02676:Fsip2 APN 2 82,812,501 (GRCm39) missense possibly damaging 0.53
IGL02717:Fsip2 APN 2 82,781,370 (GRCm39) splice site probably benign
IGL02805:Fsip2 APN 2 82,823,839 (GRCm39) missense probably benign 0.01
IGL02943:Fsip2 APN 2 82,822,701 (GRCm39) missense probably benign 0.32
IGL02965:Fsip2 APN 2 82,813,398 (GRCm39) missense probably benign 0.33
IGL03001:Fsip2 APN 2 82,820,968 (GRCm39) intron probably benign
IGL03076:Fsip2 APN 2 82,812,482 (GRCm39) missense possibly damaging 0.96
IGL03229:Fsip2 APN 2 82,808,420 (GRCm39) missense possibly damaging 0.86
IGL03353:Fsip2 APN 2 82,807,737 (GRCm39) missense possibly damaging 0.85
IGL03401:Fsip2 APN 2 82,820,814 (GRCm39) missense probably benign
bubblegum UTSW 2 82,823,184 (GRCm39) missense probably benign 0.16
Dao UTSW 2 82,823,494 (GRCm39) missense probably damaging 0.97
engulf UTSW 2 82,815,120 (GRCm39) missense probably damaging 0.98
envelope UTSW 2 82,811,085 (GRCm39) missense probably benign 0.07
gladius UTSW 2 82,812,293 (GRCm39) missense possibly damaging 0.68
glove UTSW 2 82,808,738 (GRCm39) missense possibly damaging 0.85
Katana UTSW 2 82,819,860 (GRCm39) missense probably benign 0.07
scarf UTSW 2 82,817,235 (GRCm39) missense probably benign
Sock UTSW 2 82,828,524 (GRCm39) missense probably benign 0.00
swaddle UTSW 2 82,813,772 (GRCm39) missense possibly damaging 0.93
wrap UTSW 2 82,817,164 (GRCm39) missense probably benign 0.04
Wrapper UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
D4186:Fsip2 UTSW 2 82,818,756 (GRCm39) missense probably benign 0.32
FR4976:Fsip2 UTSW 2 82,814,709 (GRCm39) critical splice acceptor site probably benign
FR4976:Fsip2 UTSW 2 82,814,706 (GRCm39) critical splice acceptor site probably benign
PIT4382001:Fsip2 UTSW 2 82,821,196 (GRCm39) missense possibly damaging 0.86
R0017:Fsip2 UTSW 2 82,822,416 (GRCm39) missense probably damaging 0.98
R0017:Fsip2 UTSW 2 82,822,416 (GRCm39) missense probably damaging 0.98
R0021:Fsip2 UTSW 2 82,830,201 (GRCm39) splice site probably benign
R0054:Fsip2 UTSW 2 82,817,299 (GRCm39) missense possibly damaging 0.85
R0054:Fsip2 UTSW 2 82,817,299 (GRCm39) missense possibly damaging 0.85
R0054:Fsip2 UTSW 2 82,806,952 (GRCm39) missense probably damaging 0.96
R0104:Fsip2 UTSW 2 82,809,317 (GRCm39) missense possibly damaging 0.91
R0104:Fsip2 UTSW 2 82,809,317 (GRCm39) missense possibly damaging 0.91
R0127:Fsip2 UTSW 2 82,815,269 (GRCm39) missense probably benign 0.28
R0131:Fsip2 UTSW 2 82,821,465 (GRCm39) missense probably benign
R0149:Fsip2 UTSW 2 82,805,849 (GRCm39) missense possibly damaging 0.93
R0167:Fsip2 UTSW 2 82,811,151 (GRCm39) missense possibly damaging 0.53
R0190:Fsip2 UTSW 2 82,815,521 (GRCm39) missense possibly damaging 0.73
R0323:Fsip2 UTSW 2 82,816,240 (GRCm39) missense probably benign 0.33
R0358:Fsip2 UTSW 2 82,813,677 (GRCm39) missense possibly damaging 0.56
R0361:Fsip2 UTSW 2 82,805,849 (GRCm39) missense possibly damaging 0.93
R0369:Fsip2 UTSW 2 82,814,908 (GRCm39) missense probably benign 0.33
R0394:Fsip2 UTSW 2 82,821,419 (GRCm39) missense possibly damaging 0.70
R0532:Fsip2 UTSW 2 82,808,129 (GRCm39) missense probably benign 0.33
R0595:Fsip2 UTSW 2 82,777,296 (GRCm39) missense probably damaging 0.99
R0613:Fsip2 UTSW 2 82,824,139 (GRCm39) missense probably damaging 0.99
R0614:Fsip2 UTSW 2 82,807,877 (GRCm39) missense probably benign 0.15
R0619:Fsip2 UTSW 2 82,774,484 (GRCm39) missense probably damaging 1.00
R0626:Fsip2 UTSW 2 82,819,302 (GRCm39) missense probably benign 0.06
R0644:Fsip2 UTSW 2 82,807,241 (GRCm39) missense probably benign 0.02
R0661:Fsip2 UTSW 2 82,816,513 (GRCm39) missense possibly damaging 0.92
R0680:Fsip2 UTSW 2 82,821,703 (GRCm39) missense possibly damaging 0.73
R0688:Fsip2 UTSW 2 82,812,683 (GRCm39) missense probably benign 0.18
R0881:Fsip2 UTSW 2 82,816,617 (GRCm39) missense possibly damaging 0.52
R0919:Fsip2 UTSW 2 82,815,828 (GRCm39) missense possibly damaging 0.53
R0973:Fsip2 UTSW 2 82,807,436 (GRCm39) missense probably benign 0.05
R0973:Fsip2 UTSW 2 82,807,436 (GRCm39) missense probably benign 0.05
R0974:Fsip2 UTSW 2 82,807,436 (GRCm39) missense probably benign 0.05
R0976:Fsip2 UTSW 2 82,828,375 (GRCm39) missense possibly damaging 0.92
R1025:Fsip2 UTSW 2 82,819,780 (GRCm39) nonsense probably null
R1026:Fsip2 UTSW 2 82,818,805 (GRCm39) missense possibly damaging 0.52
R1140:Fsip2 UTSW 2 82,805,378 (GRCm39) missense probably damaging 0.99
R1170:Fsip2 UTSW 2 82,821,844 (GRCm39) missense possibly damaging 0.72
R1180:Fsip2 UTSW 2 82,805,570 (GRCm39) missense probably damaging 0.99
R1188:Fsip2 UTSW 2 82,805,361 (GRCm39) missense possibly damaging 0.96
R1226:Fsip2 UTSW 2 82,811,355 (GRCm39) missense probably damaging 0.96
R1248:Fsip2 UTSW 2 82,820,107 (GRCm39) missense possibly damaging 0.93
R1273:Fsip2 UTSW 2 82,819,752 (GRCm39) missense possibly damaging 0.92
R1323:Fsip2 UTSW 2 82,816,096 (GRCm39) missense probably damaging 1.00
R1323:Fsip2 UTSW 2 82,816,096 (GRCm39) missense probably damaging 1.00
R1356:Fsip2 UTSW 2 82,820,089 (GRCm39) missense probably benign 0.38
R1413:Fsip2 UTSW 2 82,818,762 (GRCm39) missense possibly damaging 0.93
R1430:Fsip2 UTSW 2 82,828,407 (GRCm39) missense possibly damaging 0.71
R1475:Fsip2 UTSW 2 82,817,539 (GRCm39) missense probably damaging 0.99
R1489:Fsip2 UTSW 2 82,810,155 (GRCm39) missense probably benign
R1520:Fsip2 UTSW 2 82,811,058 (GRCm39) missense possibly damaging 0.96
R1543:Fsip2 UTSW 2 82,811,931 (GRCm39) missense possibly damaging 0.91
R1581:Fsip2 UTSW 2 82,816,626 (GRCm39) missense probably damaging 0.98
R1590:Fsip2 UTSW 2 82,813,131 (GRCm39) missense probably benign 0.26
R1646:Fsip2 UTSW 2 82,808,861 (GRCm39) missense probably benign 0.07
R1678:Fsip2 UTSW 2 82,816,689 (GRCm39) missense probably benign
R1700:Fsip2 UTSW 2 82,822,081 (GRCm39) missense probably benign 0.33
R1717:Fsip2 UTSW 2 82,805,289 (GRCm39) missense possibly damaging 0.68
R1741:Fsip2 UTSW 2 82,820,256 (GRCm39) missense probably benign 0.32
R1760:Fsip2 UTSW 2 82,818,055 (GRCm39) missense possibly damaging 0.71
R1760:Fsip2 UTSW 2 82,815,240 (GRCm39) missense probably benign 0.07
R1760:Fsip2 UTSW 2 82,830,185 (GRCm39) missense possibly damaging 0.85
R1789:Fsip2 UTSW 2 82,807,906 (GRCm39) missense probably benign 0.00
R1850:Fsip2 UTSW 2 82,814,933 (GRCm39) missense possibly damaging 0.72
R1854:Fsip2 UTSW 2 82,823,601 (GRCm39) missense possibly damaging 0.84
R1888:Fsip2 UTSW 2 82,774,504 (GRCm39) missense probably benign 0.04
R1888:Fsip2 UTSW 2 82,774,504 (GRCm39) missense probably benign 0.04
R1905:Fsip2 UTSW 2 82,813,772 (GRCm39) missense possibly damaging 0.93
R1907:Fsip2 UTSW 2 82,813,772 (GRCm39) missense possibly damaging 0.93
R1920:Fsip2 UTSW 2 82,817,164 (GRCm39) missense probably benign 0.04
R1921:Fsip2 UTSW 2 82,817,164 (GRCm39) missense probably benign 0.04
R1921:Fsip2 UTSW 2 82,811,127 (GRCm39) nonsense probably null
R1931:Fsip2 UTSW 2 82,817,077 (GRCm39) missense probably damaging 0.99
R1934:Fsip2 UTSW 2 82,810,902 (GRCm39) missense possibly damaging 0.91
R1959:Fsip2 UTSW 2 82,821,894 (GRCm39) missense probably benign
R1965:Fsip2 UTSW 2 82,823,124 (GRCm39) missense possibly damaging 0.86
R1966:Fsip2 UTSW 2 82,823,124 (GRCm39) missense possibly damaging 0.86
R1983:Fsip2 UTSW 2 82,810,175 (GRCm39) missense probably benign
R1988:Fsip2 UTSW 2 82,806,861 (GRCm39) missense possibly damaging 0.56
R2016:Fsip2 UTSW 2 82,813,076 (GRCm39) missense possibly damaging 0.53
R2017:Fsip2 UTSW 2 82,813,076 (GRCm39) missense possibly damaging 0.53
R2026:Fsip2 UTSW 2 82,819,788 (GRCm39) missense possibly damaging 0.71
R2034:Fsip2 UTSW 2 82,819,838 (GRCm39) missense probably benign 0.43
R2037:Fsip2 UTSW 2 82,808,856 (GRCm39) missense probably damaging 0.99
R2070:Fsip2 UTSW 2 82,806,699 (GRCm39) missense probably damaging 0.98
R2072:Fsip2 UTSW 2 82,839,159 (GRCm39) missense possibly damaging 0.53
R2075:Fsip2 UTSW 2 82,818,923 (GRCm39) missense possibly damaging 0.85
R2143:Fsip2 UTSW 2 82,820,615 (GRCm39) missense possibly damaging 0.93
R2207:Fsip2 UTSW 2 82,807,823 (GRCm39) missense probably benign 0.02
R2256:Fsip2 UTSW 2 82,793,095 (GRCm39) missense probably benign 0.07
R2315:Fsip2 UTSW 2 82,805,437 (GRCm39) missense probably benign
R2344:Fsip2 UTSW 2 82,820,257 (GRCm39) missense possibly damaging 0.71
R2377:Fsip2 UTSW 2 82,806,593 (GRCm39) missense probably benign 0.29
R2403:Fsip2 UTSW 2 82,811,064 (GRCm39) missense possibly damaging 0.53
R2441:Fsip2 UTSW 2 82,815,685 (GRCm39) missense possibly damaging 0.53
R2504:Fsip2 UTSW 2 82,809,954 (GRCm39) missense possibly damaging 0.86
R2510:Fsip2 UTSW 2 82,816,782 (GRCm39) missense probably benign
R2511:Fsip2 UTSW 2 82,816,782 (GRCm39) missense probably benign
R2511:Fsip2 UTSW 2 82,782,001 (GRCm39) missense probably damaging 1.00
R2512:Fsip2 UTSW 2 82,808,511 (GRCm39) missense probably benign 0.04
R2568:Fsip2 UTSW 2 82,820,775 (GRCm39) missense probably benign 0.14
R2656:Fsip2 UTSW 2 82,809,389 (GRCm39) missense possibly damaging 0.83
R2883:Fsip2 UTSW 2 82,821,868 (GRCm39) missense possibly damaging 0.86
R3417:Fsip2 UTSW 2 82,816,854 (GRCm39) missense possibly damaging 0.51
R3431:Fsip2 UTSW 2 82,822,354 (GRCm39) missense possibly damaging 0.85
R3441:Fsip2 UTSW 2 82,817,071 (GRCm39) missense probably benign 0.00
R3605:Fsip2 UTSW 2 82,815,253 (GRCm39) missense probably benign 0.28
R3620:Fsip2 UTSW 2 82,810,602 (GRCm39) missense probably benign 0.00
R3621:Fsip2 UTSW 2 82,810,602 (GRCm39) missense probably benign 0.00
R3726:Fsip2 UTSW 2 82,819,311 (GRCm39) missense possibly damaging 0.84
R3755:Fsip2 UTSW 2 82,808,561 (GRCm39) missense probably benign 0.26
R3789:Fsip2 UTSW 2 82,813,058 (GRCm39) missense probably damaging 0.96
R3836:Fsip2 UTSW 2 82,781,290 (GRCm39) missense probably damaging 1.00
R3844:Fsip2 UTSW 2 82,819,950 (GRCm39) missense possibly damaging 0.52
R3846:Fsip2 UTSW 2 82,816,759 (GRCm39) missense possibly damaging 0.52
R3861:Fsip2 UTSW 2 82,815,120 (GRCm39) missense probably damaging 0.98
R3981:Fsip2 UTSW 2 82,789,006 (GRCm39) missense probably benign 0.08
R4014:Fsip2 UTSW 2 82,813,862 (GRCm39) missense probably benign
R4042:Fsip2 UTSW 2 82,813,896 (GRCm39) missense probably benign 0.02
R4075:Fsip2 UTSW 2 82,813,245 (GRCm39) missense probably benign 0.26
R4154:Fsip2 UTSW 2 82,817,413 (GRCm39) missense possibly damaging 0.71
R4210:Fsip2 UTSW 2 82,805,493 (GRCm39) missense probably damaging 0.99
R4211:Fsip2 UTSW 2 82,805,493 (GRCm39) missense probably damaging 0.99
R4327:Fsip2 UTSW 2 82,817,403 (GRCm39) missense probably benign 0.25
R4332:Fsip2 UTSW 2 82,808,201 (GRCm39) missense probably benign 0.00
R4440:Fsip2 UTSW 2 82,821,550 (GRCm39) missense possibly damaging 0.85
R4454:Fsip2 UTSW 2 82,821,120 (GRCm39) missense possibly damaging 0.70
R4455:Fsip2 UTSW 2 82,821,120 (GRCm39) missense possibly damaging 0.70
R4457:Fsip2 UTSW 2 82,821,120 (GRCm39) missense possibly damaging 0.70
R4458:Fsip2 UTSW 2 82,821,120 (GRCm39) missense possibly damaging 0.70
R4540:Fsip2 UTSW 2 82,782,009 (GRCm39) missense probably benign
R4549:Fsip2 UTSW 2 82,819,972 (GRCm39) missense probably damaging 0.99
R4558:Fsip2 UTSW 2 82,815,297 (GRCm39) missense possibly damaging 0.73
R4573:Fsip2 UTSW 2 82,816,510 (GRCm39) missense possibly damaging 0.71
R4583:Fsip2 UTSW 2 82,809,017 (GRCm39) missense probably benign 0.33
R4618:Fsip2 UTSW 2 82,818,103 (GRCm39) missense probably benign
R4700:Fsip2 UTSW 2 82,817,373 (GRCm39) missense probably benign 0.32
R4716:Fsip2 UTSW 2 82,805,203 (GRCm39) missense probably damaging 0.96
R4739:Fsip2 UTSW 2 82,805,697 (GRCm39) missense possibly damaging 0.92
R4749:Fsip2 UTSW 2 82,819,629 (GRCm39) missense probably benign 0.06
R4791:Fsip2 UTSW 2 82,812,452 (GRCm39) missense possibly damaging 0.53
R4793:Fsip2 UTSW 2 82,818,044 (GRCm39) nonsense probably null
R4819:Fsip2 UTSW 2 82,818,786 (GRCm39) missense probably benign 0.06
R4832:Fsip2 UTSW 2 82,820,515 (GRCm39) missense possibly damaging 0.92
R4840:Fsip2 UTSW 2 82,815,815 (GRCm39) missense probably benign 0.26
R4840:Fsip2 UTSW 2 82,779,739 (GRCm39) missense probably benign 0.01
R4865:Fsip2 UTSW 2 82,821,295 (GRCm39) missense possibly damaging 0.86
R4876:Fsip2 UTSW 2 82,805,202 (GRCm39) missense possibly damaging 0.91
R4885:Fsip2 UTSW 2 82,818,438 (GRCm39) missense probably benign 0.02
R4911:Fsip2 UTSW 2 82,811,837 (GRCm39) missense possibly damaging 0.85
R4918:Fsip2 UTSW 2 82,824,114 (GRCm39) missense possibly damaging 0.51
R4936:Fsip2 UTSW 2 82,815,384 (GRCm39) missense probably benign 0.18
R4950:Fsip2 UTSW 2 82,807,758 (GRCm39) missense probably benign 0.03
R4950:Fsip2 UTSW 2 82,777,276 (GRCm39) missense probably damaging 0.97
R4959:Fsip2 UTSW 2 82,815,169 (GRCm39) missense probably benign 0.00
R4971:Fsip2 UTSW 2 82,816,222 (GRCm39) missense probably benign 0.38
R4973:Fsip2 UTSW 2 82,815,169 (GRCm39) missense probably benign 0.00
R4976:Fsip2 UTSW 2 82,818,535 (GRCm39) missense probably damaging 0.99
R5022:Fsip2 UTSW 2 82,809,773 (GRCm39) missense probably benign 0.33
R5027:Fsip2 UTSW 2 82,819,477 (GRCm39) missense possibly damaging 0.71
R5030:Fsip2 UTSW 2 82,818,836 (GRCm39) missense possibly damaging 0.85
R5048:Fsip2 UTSW 2 82,823,494 (GRCm39) missense probably damaging 0.97
R5096:Fsip2 UTSW 2 82,821,460 (GRCm39) missense probably benign 0.00
R5097:Fsip2 UTSW 2 82,822,329 (GRCm39) missense probably benign
R5119:Fsip2 UTSW 2 82,818,535 (GRCm39) missense probably damaging 0.99
R5138:Fsip2 UTSW 2 82,811,768 (GRCm39) missense probably benign 0.12
R5152:Fsip2 UTSW 2 82,808,916 (GRCm39) missense probably benign 0.43
R5174:Fsip2 UTSW 2 82,811,085 (GRCm39) missense probably benign 0.07
R5245:Fsip2 UTSW 2 82,823,505 (GRCm39) missense probably benign 0.02
R5282:Fsip2 UTSW 2 82,808,925 (GRCm39) missense possibly damaging 0.61
R5323:Fsip2 UTSW 2 82,818,489 (GRCm39) missense possibly damaging 0.71
R5326:Fsip2 UTSW 2 82,812,207 (GRCm39) missense possibly damaging 0.84
R5378:Fsip2 UTSW 2 82,820,185 (GRCm39) missense possibly damaging 0.71
R5380:Fsip2 UTSW 2 82,805,742 (GRCm39) missense possibly damaging 0.91
R5396:Fsip2 UTSW 2 82,821,262 (GRCm39) missense probably benign 0.00
R5422:Fsip2 UTSW 2 82,812,572 (GRCm39) missense probably benign 0.00
R5481:Fsip2 UTSW 2 82,810,230 (GRCm39) missense probably benign 0.26
R5482:Fsip2 UTSW 2 82,815,654 (GRCm39) missense possibly damaging 0.80
R5513:Fsip2 UTSW 2 82,815,542 (GRCm39) missense possibly damaging 0.72
R5513:Fsip2 UTSW 2 82,781,256 (GRCm39) missense probably benign 0.07
R5513:Fsip2 UTSW 2 82,781,252 (GRCm39) missense probably damaging 1.00
R5536:Fsip2 UTSW 2 82,817,403 (GRCm39) missense probably benign 0.25
R5542:Fsip2 UTSW 2 82,812,207 (GRCm39) missense possibly damaging 0.84
R5553:Fsip2 UTSW 2 82,793,090 (GRCm39) missense probably benign
R5568:Fsip2 UTSW 2 82,816,908 (GRCm39) missense probably benign 0.25
R5581:Fsip2 UTSW 2 82,828,472 (GRCm39) missense possibly damaging 0.84
R5664:Fsip2 UTSW 2 82,818,439 (GRCm39) missense probably benign 0.05
R5672:Fsip2 UTSW 2 82,817,838 (GRCm39) nonsense probably null
R5712:Fsip2 UTSW 2 82,839,192 (GRCm39) missense possibly damaging 0.73
R5762:Fsip2 UTSW 2 82,808,260 (GRCm39) missense probably benign 0.33
R5772:Fsip2 UTSW 2 82,815,084 (GRCm39) missense probably benign
R5881:Fsip2 UTSW 2 82,814,785 (GRCm39) missense possibly damaging 0.72
R5919:Fsip2 UTSW 2 82,822,953 (GRCm39) missense possibly damaging 0.71
R5920:Fsip2 UTSW 2 82,818,852 (GRCm39) nonsense probably null
R5934:Fsip2 UTSW 2 82,817,092 (GRCm39) missense possibly damaging 0.86
R5938:Fsip2 UTSW 2 82,807,835 (GRCm39) missense probably benign 0.00
R5974:Fsip2 UTSW 2 82,793,657 (GRCm39) missense possibly damaging 0.68
R5991:Fsip2 UTSW 2 82,820,812 (GRCm39) missense probably benign 0.28
R6019:Fsip2 UTSW 2 82,818,283 (GRCm39) missense possibly damaging 0.52
R6020:Fsip2 UTSW 2 82,822,471 (GRCm39) missense probably damaging 0.99
R6056:Fsip2 UTSW 2 82,816,017 (GRCm39) missense probably benign 0.01
R6057:Fsip2 UTSW 2 82,809,777 (GRCm39) missense probably damaging 0.99
R6139:Fsip2 UTSW 2 82,821,388 (GRCm39) missense possibly damaging 0.85
R6145:Fsip2 UTSW 2 82,824,112 (GRCm39) missense possibly damaging 0.71
R6160:Fsip2 UTSW 2 82,818,289 (GRCm39) nonsense probably null
R6161:Fsip2 UTSW 2 82,817,601 (GRCm39) missense possibly damaging 0.80
R6166:Fsip2 UTSW 2 82,811,071 (GRCm39) missense probably benign 0.00
R6187:Fsip2 UTSW 2 82,812,798 (GRCm39) missense probably benign 0.33
R6196:Fsip2 UTSW 2 82,820,227 (GRCm39) missense possibly damaging 0.71
R6217:Fsip2 UTSW 2 82,818,762 (GRCm39) missense possibly damaging 0.93
R6276:Fsip2 UTSW 2 82,810,785 (GRCm39) missense possibly damaging 0.91
R6278:Fsip2 UTSW 2 82,819,242 (GRCm39) missense probably benign 0.16
R6349:Fsip2 UTSW 2 82,823,416 (GRCm39) missense probably benign 0.05
R6351:Fsip2 UTSW 2 82,823,028 (GRCm39) missense possibly damaging 0.51
R6401:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6404:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6405:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6437:Fsip2 UTSW 2 82,813,836 (GRCm39) missense possibly damaging 0.73
R6478:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6479:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6480:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6481:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6521:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6529:Fsip2 UTSW 2 82,812,657 (GRCm39) missense probably benign
R6621:Fsip2 UTSW 2 82,820,158 (GRCm39) missense possibly damaging 0.93
R6639:Fsip2 UTSW 2 82,813,571 (GRCm39) missense possibly damaging 0.85
R6649:Fsip2 UTSW 2 82,798,161 (GRCm39) missense possibly damaging 0.83
R6714:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6714:Fsip2 UTSW 2 82,809,878 (GRCm39) missense probably benign 0.01
R6749:Fsip2 UTSW 2 82,808,738 (GRCm39) missense possibly damaging 0.85
R6765:Fsip2 UTSW 2 82,816,776 (GRCm39) missense probably benign
R6790:Fsip2 UTSW 2 82,821,283 (GRCm39) missense possibly damaging 0.53
R6793:Fsip2 UTSW 2 82,819,838 (GRCm39) missense probably benign 0.43
R6795:Fsip2 UTSW 2 82,811,303 (GRCm39) missense probably benign 0.08
R6818:Fsip2 UTSW 2 82,815,544 (GRCm39) missense probably benign 0.04
R6844:Fsip2 UTSW 2 82,813,969 (GRCm39) missense possibly damaging 0.72
R6848:Fsip2 UTSW 2 82,813,131 (GRCm39) missense probably benign 0.26
R6945:Fsip2 UTSW 2 82,823,184 (GRCm39) missense probably benign 0.16
R6950:Fsip2 UTSW 2 82,816,332 (GRCm39) missense probably benign 0.03
R6951:Fsip2 UTSW 2 82,812,293 (GRCm39) missense possibly damaging 0.68
R6974:Fsip2 UTSW 2 82,809,061 (GRCm39) missense probably damaging 0.96
R6987:Fsip2 UTSW 2 82,778,630 (GRCm39) nonsense probably null
R6989:Fsip2 UTSW 2 82,807,298 (GRCm39) missense probably benign 0.00
R7001:Fsip2 UTSW 2 82,817,269 (GRCm39) missense probably damaging 1.00
R7002:Fsip2 UTSW 2 82,819,687 (GRCm39) missense possibly damaging 0.86
R7016:Fsip2 UTSW 2 82,820,979 (GRCm39) missense probably benign 0.25
R7066:Fsip2 UTSW 2 82,821,235 (GRCm39) missense possibly damaging 0.86
R7067:Fsip2 UTSW 2 82,811,078 (GRCm39) missense possibly damaging 0.85
R7077:Fsip2 UTSW 2 82,813,496 (GRCm39) missense probably benign 0.18
R7099:Fsip2 UTSW 2 82,817,968 (GRCm39) missense probably benign
R7126:Fsip2 UTSW 2 82,813,485 (GRCm39) missense possibly damaging 0.53
R7156:Fsip2 UTSW 2 82,813,085 (GRCm39) missense probably benign 0.00
R7165:Fsip2 UTSW 2 82,811,541 (GRCm39) missense possibly damaging 0.77
R7171:Fsip2 UTSW 2 82,816,571 (GRCm39) nonsense probably null
R7189:Fsip2 UTSW 2 82,823,581 (GRCm39) missense possibly damaging 0.92
R7217:Fsip2 UTSW 2 82,819,412 (GRCm39) missense possibly damaging 0.85
R7222:Fsip2 UTSW 2 82,814,015 (GRCm39) missense probably benign
R7228:Fsip2 UTSW 2 82,822,651 (GRCm39) missense possibly damaging 0.93
R7238:Fsip2 UTSW 2 82,812,484 (GRCm39) missense possibly damaging 0.72
R7244:Fsip2 UTSW 2 82,823,607 (GRCm39) missense possibly damaging 0.92
R7251:Fsip2 UTSW 2 82,809,425 (GRCm39) missense possibly damaging 0.95
R7259:Fsip2 UTSW 2 82,812,474 (GRCm39) missense possibly damaging 0.85
R7291:Fsip2 UTSW 2 82,810,863 (GRCm39) missense possibly damaging 0.91
R7316:Fsip2 UTSW 2 82,820,035 (GRCm39) missense possibly damaging 0.93
R7323:Fsip2 UTSW 2 82,819,860 (GRCm39) missense probably benign 0.07
R7335:Fsip2 UTSW 2 82,813,462 (GRCm39) missense probably benign
R7343:Fsip2 UTSW 2 82,809,711 (GRCm39) missense probably benign 0.07
R7346:Fsip2 UTSW 2 82,828,524 (GRCm39) missense probably benign 0.00
R7389:Fsip2 UTSW 2 82,819,140 (GRCm39) missense possibly damaging 0.51
R7391:Fsip2 UTSW 2 82,820,663 (GRCm39) missense possibly damaging 0.70
R7397:Fsip2 UTSW 2 82,815,601 (GRCm39) missense possibly damaging 0.53
R7426:Fsip2 UTSW 2 82,810,441 (GRCm39) missense probably damaging 0.98
R7450:Fsip2 UTSW 2 82,782,024 (GRCm39) missense probably benign 0.30
R7538:Fsip2 UTSW 2 82,818,894 (GRCm39) missense possibly damaging 0.86
R7542:Fsip2 UTSW 2 82,815,196 (GRCm39) missense possibly damaging 0.96
R7549:Fsip2 UTSW 2 82,824,337 (GRCm39) missense probably damaging 0.99
R7564:Fsip2 UTSW 2 82,819,361 (GRCm39) missense probably benign 0.02
R7565:Fsip2 UTSW 2 82,779,856 (GRCm39) missense probably damaging 0.97
R7583:Fsip2 UTSW 2 82,805,585 (GRCm39) missense probably benign 0.12
R7641:Fsip2 UTSW 2 82,817,256 (GRCm39) nonsense probably null
R7655:Fsip2 UTSW 2 82,807,886 (GRCm39) missense possibly damaging 0.91
R7656:Fsip2 UTSW 2 82,807,886 (GRCm39) missense possibly damaging 0.91
R7665:Fsip2 UTSW 2 82,812,149 (GRCm39) missense probably benign 0.03
R7672:Fsip2 UTSW 2 82,820,455 (GRCm39) missense possibly damaging 0.93
R7764:Fsip2 UTSW 2 82,811,252 (GRCm39) missense possibly damaging 0.93
R7790:Fsip2 UTSW 2 82,818,723 (GRCm39) missense probably benign
R7811:Fsip2 UTSW 2 82,828,797 (GRCm39) missense possibly damaging 0.93
R7838:Fsip2 UTSW 2 82,807,044 (GRCm39) missense probably benign 0.00
R7873:Fsip2 UTSW 2 82,779,856 (GRCm39) missense probably damaging 0.97
R7902:Fsip2 UTSW 2 82,808,168 (GRCm39) missense possibly damaging 0.72
R7920:Fsip2 UTSW 2 82,781,365 (GRCm39) missense possibly damaging 0.94
R7959:Fsip2 UTSW 2 82,816,120 (GRCm39) missense possibly damaging 0.51
R8009:Fsip2 UTSW 2 82,818,793 (GRCm39) missense possibly damaging 0.85
R8031:Fsip2 UTSW 2 82,817,235 (GRCm39) missense probably benign
R8034:Fsip2 UTSW 2 82,819,699 (GRCm39) missense possibly damaging 0.92
R8037:Fsip2 UTSW 2 82,816,322 (GRCm39) missense possibly damaging 0.72
R8110:Fsip2 UTSW 2 82,789,017 (GRCm39) missense probably benign 0.00
R8117:Fsip2 UTSW 2 82,823,296 (GRCm39) missense possibly damaging 0.86
R8138:Fsip2 UTSW 2 82,806,141 (GRCm39) missense possibly damaging 0.83
R8175:Fsip2 UTSW 2 82,818,021 (GRCm39) missense probably benign 0.16
R8175:Fsip2 UTSW 2 82,815,088 (GRCm39) missense probably benign 0.06
R8182:Fsip2 UTSW 2 82,806,951 (GRCm39) missense probably damaging 0.99
R8206:Fsip2 UTSW 2 82,820,808 (GRCm39) missense possibly damaging 0.85
R8229:Fsip2 UTSW 2 82,808,487 (GRCm39) missense possibly damaging 0.63
R8239:Fsip2 UTSW 2 82,819,687 (GRCm39) missense possibly damaging 0.71
R8245:Fsip2 UTSW 2 82,811,346 (GRCm39) missense possibly damaging 0.79
R8303:Fsip2 UTSW 2 82,818,724 (GRCm39) missense probably benign 0.00
R8336:Fsip2 UTSW 2 82,821,099 (GRCm39) missense possibly damaging 0.53
R8347:Fsip2 UTSW 2 82,818,198 (GRCm39) missense probably benign 0.16
R8351:Fsip2 UTSW 2 82,822,239 (GRCm39) missense possibly damaging 0.73
R8352:Fsip2 UTSW 2 82,814,937 (GRCm39) missense probably benign
R8419:Fsip2 UTSW 2 82,808,963 (GRCm39) missense probably damaging 0.96
R8431:Fsip2 UTSW 2 82,811,910 (GRCm39) missense probably damaging 1.00
R8439:Fsip2 UTSW 2 82,807,430 (GRCm39) missense probably benign 0.24
R8452:Fsip2 UTSW 2 82,814,937 (GRCm39) missense probably benign
R8459:Fsip2 UTSW 2 82,810,022 (GRCm39) missense possibly damaging 0.95
R8465:Fsip2 UTSW 2 82,810,284 (GRCm39) missense probably benign 0.26
R8473:Fsip2 UTSW 2 82,777,336 (GRCm39) missense probably damaging 0.99
R8703:Fsip2 UTSW 2 82,821,871 (GRCm39) missense probably damaging 0.98
R8711:Fsip2 UTSW 2 82,815,246 (GRCm39) missense possibly damaging 0.53
R8713:Fsip2 UTSW 2 82,811,453 (GRCm39) missense probably damaging 1.00
R8789:Fsip2 UTSW 2 82,815,822 (GRCm39) missense possibly damaging 0.73
R8805:Fsip2 UTSW 2 82,813,453 (GRCm39) missense possibly damaging 0.46
R8840:Fsip2 UTSW 2 82,821,606 (GRCm39) missense probably benign 0.03
R8855:Fsip2 UTSW 2 82,810,521 (GRCm39) missense probably benign 0.04
R8866:Fsip2 UTSW 2 82,810,521 (GRCm39) missense probably benign 0.04
R8875:Fsip2 UTSW 2 82,820,782 (GRCm39) missense possibly damaging 0.95
R8883:Fsip2 UTSW 2 82,809,524 (GRCm39) missense possibly damaging 0.68
R8903:Fsip2 UTSW 2 82,807,681 (GRCm39) missense possibly damaging 0.83
R8907:Fsip2 UTSW 2 82,816,984 (GRCm39) missense probably benign 0.20
R8912:Fsip2 UTSW 2 82,810,938 (GRCm39) missense probably benign
R8926:Fsip2 UTSW 2 82,823,927 (GRCm39) missense possibly damaging 0.84
R8991:Fsip2 UTSW 2 82,815,370 (GRCm39) missense probably benign 0.33
R9014:Fsip2 UTSW 2 82,806,898 (GRCm39) missense probably benign 0.32
R9014:Fsip2 UTSW 2 82,817,075 (GRCm39) missense possibly damaging 0.71
R9039:Fsip2 UTSW 2 82,828,545 (GRCm39) missense probably benign 0.32
R9054:Fsip2 UTSW 2 82,806,180 (GRCm39) missense possibly damaging 0.68
R9114:Fsip2 UTSW 2 82,807,301 (GRCm39) missense probably benign 0.00
R9124:Fsip2 UTSW 2 82,816,103 (GRCm39) missense probably benign 0.00
R9131:Fsip2 UTSW 2 82,813,170 (GRCm39) missense probably benign
R9149:Fsip2 UTSW 2 82,812,374 (GRCm39) missense possibly damaging 0.86
R9180:Fsip2 UTSW 2 82,815,574 (GRCm39) missense possibly damaging 0.96
R9192:Fsip2 UTSW 2 82,817,844 (GRCm39) missense probably benign 0.06
R9216:Fsip2 UTSW 2 82,820,425 (GRCm39) missense probably damaging 0.99
R9218:Fsip2 UTSW 2 82,823,062 (GRCm39) missense probably damaging 0.97
R9222:Fsip2 UTSW 2 82,815,958 (GRCm39) missense probably benign 0.00
R9262:Fsip2 UTSW 2 82,807,662 (GRCm39) missense probably benign 0.00
R9340:Fsip2 UTSW 2 82,818,604 (GRCm39) missense possibly damaging 0.71
R9342:Fsip2 UTSW 2 82,818,747 (GRCm39) missense possibly damaging 0.71
R9368:Fsip2 UTSW 2 82,811,039 (GRCm39) missense possibly damaging 0.68
R9372:Fsip2 UTSW 2 82,822,756 (GRCm39) missense possibly damaging 0.71
R9385:Fsip2 UTSW 2 82,819,793 (GRCm39) missense possibly damaging 0.84
R9432:Fsip2 UTSW 2 82,805,907 (GRCm39) missense probably damaging 0.98
R9434:Fsip2 UTSW 2 82,816,702 (GRCm39) missense possibly damaging 0.71
R9445:Fsip2 UTSW 2 82,806,132 (GRCm39) missense probably damaging 0.99
R9472:Fsip2 UTSW 2 82,817,285 (GRCm39) missense possibly damaging 0.85
R9496:Fsip2 UTSW 2 82,793,062 (GRCm39) missense probably benign
R9523:Fsip2 UTSW 2 82,807,972 (GRCm39) missense probably damaging 0.99
R9567:Fsip2 UTSW 2 82,798,173 (GRCm39) missense probably benign
R9636:Fsip2 UTSW 2 82,820,563 (GRCm39) missense possibly damaging 0.52
R9643:Fsip2 UTSW 2 82,821,984 (GRCm39) missense possibly damaging 0.53
R9680:Fsip2 UTSW 2 82,819,272 (GRCm39) missense probably benign 0.32
R9695:Fsip2 UTSW 2 82,806,226 (GRCm39) missense probably benign
R9705:Fsip2 UTSW 2 82,823,634 (GRCm39) missense probably benign
R9739:Fsip2 UTSW 2 82,823,896 (GRCm39) missense possibly damaging 0.71
R9751:Fsip2 UTSW 2 82,818,241 (GRCm39) missense probably benign 0.00
R9761:Fsip2 UTSW 2 82,821,994 (GRCm39) missense probably benign 0.00
R9798:Fsip2 UTSW 2 82,810,225 (GRCm39) nonsense probably null
RF003:Fsip2 UTSW 2 82,821,865 (GRCm39) missense probably benign 0.02
RF005:Fsip2 UTSW 2 82,822,876 (GRCm39) missense probably benign 0.04
RF008:Fsip2 UTSW 2 82,808,184 (GRCm39) missense probably benign
RF028:Fsip2 UTSW 2 82,824,352 (GRCm39) frame shift probably null
RF029:Fsip2 UTSW 2 82,824,352 (GRCm39) frame shift probably null
RF036:Fsip2 UTSW 2 82,814,707 (GRCm39) critical splice acceptor site probably benign
RF038:Fsip2 UTSW 2 82,824,352 (GRCm39) frame shift probably null
RF062:Fsip2 UTSW 2 82,814,707 (GRCm39) critical splice acceptor site probably benign
X0018:Fsip2 UTSW 2 82,812,851 (GRCm39) nonsense probably null
X0020:Fsip2 UTSW 2 82,781,364 (GRCm39) missense probably damaging 1.00
X0025:Fsip2 UTSW 2 82,785,290 (GRCm39) missense possibly damaging 0.70
X0027:Fsip2 UTSW 2 82,807,122 (GRCm39) missense probably benign 0.35
X0066:Fsip2 UTSW 2 82,817,807 (GRCm39) missense possibly damaging 0.51
Z1088:Fsip2 UTSW 2 82,818,978 (GRCm39) missense possibly damaging 0.85
Z1088:Fsip2 UTSW 2 82,817,997 (GRCm39) missense possibly damaging 0.86
Z1088:Fsip2 UTSW 2 82,805,792 (GRCm39) missense probably damaging 0.96
Z1176:Fsip2 UTSW 2 82,820,009 (GRCm39) missense probably benign 0.02
Z1177:Fsip2 UTSW 2 82,814,868 (GRCm39) missense probably damaging 0.98
Z1177:Fsip2 UTSW 2 82,777,304 (GRCm39) missense probably damaging 0.99
Z1177:Fsip2 UTSW 2 82,817,547 (GRCm39) missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TGCTCCCATTTTGAAGAGTCTTTG -3'
(R):5'- CTCCCTTGAGGAAGAAAGTTGTG -3'

Sequencing Primer
(F):5'- GAGTCTTTGATCAAAAACCTTCCC -3'
(R):5'- GAGTTTTTGTGACTTGCTCAAATG -3'
Posted On 2016-07-06