Mutagenetix > Incidental Mutations

Incidental Mutation 'R5257:Ttc6'

399809

Institutional Source

Beutler Lab

Gene Symbol

Ttc6

Ensembl Gene

ENSMUSG00000046782

Gene Name

tetratricopeptide repeat domain 6

Synonyms

EG639426, LOC217602, Gm9813

MMRRC Submission

042855-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.197) question?

Stock #

R5257 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57564113-57737928 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 57702275 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1331 (D1331V)

Ref Sequence

ENSEMBL: ENSMUSP00000134273 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172939]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172939
AA Change: D1331V

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000134273
Gene: ENSMUSG00000046782
AA Change: D1331V

Domain	Start	End	E-Value	Type
coiled coil region	18	42	N/A	INTRINSIC
low complexity region	146	162	N/A	INTRINSIC
low complexity region	188	212	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC
low complexity region	486	495	N/A	INTRINSIC
low complexity region	670	685	N/A	INTRINSIC
low complexity region	733	740	N/A	INTRINSIC
TPR	889	922	2e-4	SMART
TPR	957	989	2.36e1	SMART
TPR	990	1022	2.63e1	SMART
TPR	1023	1056	9.39e-1	SMART
TPR	1057	1090	3.78e-5	SMART
Blast:TPR	1126	1157	1e-11	BLAST
SEL1	1160	1192	3.39e1	SMART
TPR	1160	1194	4.44e1	SMART
TPR	1195	1228	7.87e0	SMART
Blast:TPR	1229	1262	1e-11	BLAST
TPR	1297	1330	1.24e0	SMART
SEL1	1341	1372	9.26e-1	SMART
TPR	1341	1374	3.45e-8	SMART
TPR	1375	1407	8.76e-1	SMART
TPR	1408	1441	1.45e-1	SMART
TPR	1442	1475	1.36e1	SMART
TPR	1476	1509	7.34e-3	SMART
TPR	1513	1546	1.01e0	SMART
TPR	1547	1580	2.55e-2	SMART
TPR	1581	1617	2.43e1	SMART
Blast:TPR	1618	1651	4e-12	BLAST
TPR	1652	1685	7.87e0	SMART
TPR	1686	1718	2.35e-1	SMART
SEL1	1719	1750	1.21e2	SMART
TPR	1719	1752	1.65e-5	SMART
TPR	1753	1786	1.66e-1	SMART
TPR	1787	1820	1.45e-1	SMART
TPR	1821	1854	3.27e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217711

Meta Mutation Damage Score

0.1894

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.5%

Validation Efficiency

97% (63/65)

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	T	11: 9,249,684	T128S	possibly damaging	Het
Abca16	T	G	7: 120,436,769		probably null	Het
Acpp	T	C	9: 104,309,475	I266V	probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Asf1b	C	T	8: 83,969,267	T179I	probably benign	Het
Astn1	A	G	1: 158,612,532	K890R	probably damaging	Het
Card11	G	A	5: 140,876,425	P1039L	possibly damaging	Het
Chsy3	A	G	18: 59,409,794	E668G	possibly damaging	Het
Cnot8	T	A	11: 58,117,522	N271K	possibly damaging	Het
Dcaf5	G	T	12: 80,397,719	P200H	probably damaging	Het
Dkk4	C	A	8: 22,627,015	L215I	probably damaging	Het
Dnhd1	C	T	7: 105,674,037	T584I	probably benign	Het
Dock3	T	C	9: 106,996,925	Y449C	probably damaging	Het
Dsg1a	A	G	18: 20,320,931	D31G	probably damaging	Het
Fgfr1op	T	C	17: 8,172,943	S152P	probably benign	Het
Foxi2	C	T	7: 135,410,527	T48M	probably benign	Het
Gdf3	T	C	6: 122,606,386	M341V	probably damaging	Het
Gm21738	A	G	14: 19,415,942	L199S	probably benign	Het
Gm4787	G	C	12: 81,377,830	T518S	probably benign	Het
Igkv4-80	T	A	6: 69,016,827	T27S	probably benign	Het
Ipo9	A	T	1: 135,385,435	C1019S	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Ktn1	T	A	14: 47,667,363	H199Q	probably benign	Het
Kyat3	A	G	3: 142,734,576	M354V	probably benign	Het
Lbhd1	A	G	19: 8,884,089		probably benign	Het
Llgl1	G	C	11: 60,711,563		probably null	Het
Lyzl6	T	A	11: 103,635,073	I74F	probably damaging	Het
Mfsd4b2	T	A	10: 39,922,021	M113L	probably benign	Het
Mslnl	T	C	17: 25,746,165	Y502H	probably benign	Het
Nckap5	A	G	1: 126,024,508	S1372P	probably damaging	Het
Nle1	T	C	11: 82,904,946	D225G	probably damaging	Het
Olfr221	T	C	14: 52,035,884	T76A	possibly damaging	Het
P2rx7	A	G	5: 122,681,003	E496G	probably damaging	Het
Padi4	C	T	4: 140,746,204	V641M	probably benign	Het
Phf11d	T	C	14: 59,352,711	I221V	possibly damaging	Het
Pla2g2c	G	A	4: 138,731,545		probably benign	Het
Prdm16	A	T	4: 154,367,214	D179E	possibly damaging	Het
Psca	A	T	15: 74,716,391	I56F	probably damaging	Het
Ptrhd1	A	G	12: 4,236,481	Y124C	probably damaging	Het
Sardh	T	C	2: 27,244,259	T82A	probably damaging	Het
Sesn1	C	T	10: 41,894,988	P172S	probably benign	Het
Setd4	T	C	16: 93,596,333	T57A	probably damaging	Het
Skint5	T	C	4: 113,577,662	T1037A	unknown	Het
Slc18a3	T	C	14: 32,463,820	D202G	probably damaging	Het
Slc44a5	G	A	3: 154,243,123	C176Y	probably damaging	Het
Slc6a5	G	A	7: 49,929,992	V373M	probably damaging	Het
Sorbs3	T	C	14: 70,185,034	I523V	probably benign	Het
Sspo	T	C	6: 48,476,494	V2872A	probably damaging	Het
Stard9	T	A	2: 120,699,343	L2027H	probably damaging	Het
Tex2	T	A	11: 106,567,759		probably benign	Het
Tfdp1	C	T	8: 13,369,529	T86M	possibly damaging	Het
Vps13b	A	G	15: 35,794,421	T2326A	possibly damaging	Het
Wnk1	A	G	6: 120,037,188	S149P	probably benign	Het
Zfp521	G	A	18: 13,846,978	S126F	probably damaging	Het
Zfp958	A	T	8: 4,628,456	E160D	probably benign	Het

Other mutations in Ttc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03278:Ttc6	APN	12	57622026	missense	probably damaging	0.99
IGL02802:Ttc6	UTSW	12	57575868	missense	probably benign	0.14
PIT4802001:Ttc6	UTSW	12	57725676	missense	possibly damaging	0.89
R0698:Ttc6	UTSW	12	57673216	missense	probably benign	0.04
R0988:Ttc6	UTSW	12	57688649	splice site	probably benign
R1290:Ttc6	UTSW	12	57660413	missense	probably benign	0.00
R1338:Ttc6	UTSW	12	57616369	missense	probably benign	0.10
R1468:Ttc6	UTSW	12	57674677	missense	possibly damaging	0.54
R1468:Ttc6	UTSW	12	57674677	missense	possibly damaging	0.54
R1481:Ttc6	UTSW	12	57737130	missense	probably damaging	1.00
R1488:Ttc6	UTSW	12	57649515	missense	possibly damaging	0.66
R1558:Ttc6	UTSW	12	57686346	missense	probably benign	0.14
R1570:Ttc6	UTSW	12	57674763	missense	probably damaging	0.98
R1619:Ttc6	UTSW	12	57737668	missense	possibly damaging	0.73
R1819:Ttc6	UTSW	12	57694500	critical splice donor site	probably null
R1826:Ttc6	UTSW	12	57660247	missense	probably benign	0.10
R1863:Ttc6	UTSW	12	57714095	missense	probably benign	0.04
R1872:Ttc6	UTSW	12	57704552	critical splice donor site	probably null
R1887:Ttc6	UTSW	12	57673258	missense	probably benign	0.04
R1937:Ttc6	UTSW	12	57616323	missense	probably benign	0.02
R2014:Ttc6	UTSW	12	57576217	missense	possibly damaging	0.92
R2056:Ttc6	UTSW	12	57737693	missense	probably benign	0.08
R2058:Ttc6	UTSW	12	57737693	missense	probably benign	0.08
R2059:Ttc6	UTSW	12	57737693	missense	probably benign	0.08
R2152:Ttc6	UTSW	12	57705552	missense	probably damaging	0.98
R2179:Ttc6	UTSW	12	57673118	missense	possibly damaging	0.62
R2275:Ttc6	UTSW	12	57702298	missense	probably benign	0.01
R2432:Ttc6	UTSW	12	57622035	missense	possibly damaging	0.79
R2474:Ttc6	UTSW	12	57575927	missense	probably benign	0.37
R2853:Ttc6	UTSW	12	57576181	missense	probably damaging	0.96
R3848:Ttc6	UTSW	12	57677146	missense	probably damaging	0.97
R3853:Ttc6	UTSW	12	57728549	missense	possibly damaging	0.88
R3950:Ttc6	UTSW	12	57649506	missense	probably damaging	0.97
R3953:Ttc6	UTSW	12	57697452	missense	probably benign	0.03
R3954:Ttc6	UTSW	12	57697452	missense	probably benign	0.03
R3955:Ttc6	UTSW	12	57697452	missense	probably benign	0.03
R3957:Ttc6	UTSW	12	57697452	missense	probably benign	0.03
R4135:Ttc6	UTSW	12	57632795	intron	probably benign
R4387:Ttc6	UTSW	12	57643050	missense	probably benign	0.00
R4577:Ttc6	UTSW	12	57576655	missense	probably benign	0.22
R4747:Ttc6	UTSW	12	57674692	missense	possibly damaging	0.86
R4779:Ttc6	UTSW	12	57729451	missense	probably damaging	1.00
R4803:Ttc6	UTSW	12	57728505	missense	probably damaging	1.00
R4871:Ttc6	UTSW	12	57702356	missense	probably damaging	0.96
R4898:Ttc6	UTSW	12	57660240	missense	probably benign	0.00
R4930:Ttc6	UTSW	12	57673823	critical splice donor site	probably null
R4946:Ttc6	UTSW	12	57643140	missense	probably benign	0.01
R5303:Ttc6	UTSW	12	57575820	missense	possibly damaging	0.90
R5385:Ttc6	UTSW	12	57643035	splice site	probably null
R5402:Ttc6	UTSW	12	57737031	nonsense	probably null
R5428:Ttc6	UTSW	12	57689834	missense	probably null	0.98
R5436:Ttc6	UTSW	12	57674594	splice site	probably null
R5646:Ttc6	UTSW	12	57576019	missense	probably damaging	0.99
R5697:Ttc6	UTSW	12	57677214	missense	probably benign	0.22
R5792:Ttc6	UTSW	12	57673204	missense	possibly damaging	0.71
R5808:Ttc6	UTSW	12	57617611	missense	possibly damaging	0.84
R5842:Ttc6	UTSW	12	57737016	missense	probably damaging	1.00
R5935:Ttc6	UTSW	12	57673804	missense	probably damaging	0.98
R6144:Ttc6	UTSW	12	57673100	missense	possibly damaging	0.83
R6155:Ttc6	UTSW	12	57737616	missense	possibly damaging	0.84
R6283:Ttc6	UTSW	12	57702262	missense	possibly damaging	0.95
R6371:Ttc6	UTSW	12	57728463	missense	possibly damaging	0.89
R6715:Ttc6	UTSW	12	57674770	critical splice donor site	probably null
R6738:Ttc6	UTSW	12	57688640	missense	probably damaging	0.99
R6795:Ttc6	UTSW	12	57704413	missense	probably damaging	0.96
R6959:Ttc6	UTSW	12	57658142	splice site	probably null
R7053:Ttc6	UTSW	12	57660532	missense	probably benign	0.01
R7125:Ttc6	UTSW	12	57576339	missense	probably benign	0.00
R7259:Ttc6	UTSW	12	57576184	missense	probably benign	0.00
R7304:Ttc6	UTSW	12	57576051	missense	probably damaging	0.96
R7369:Ttc6	UTSW	12	57672931	critical splice acceptor site	probably null
R7409:Ttc6	UTSW	12	57696986	missense	probably damaging	0.99
R7429:Ttc6	UTSW	12	57658102	missense	probably benign	0.00
R7430:Ttc6	UTSW	12	57658102	missense	probably benign	0.00
R7492:Ttc6	UTSW	12	57673136	missense	probably benign	0.02
R7535:Ttc6	UTSW	12	57576519	missense	probably benign	0.00
R7866:Ttc6	UTSW	12	57674649	missense	probably damaging	0.97
R7901:Ttc6	UTSW	12	57688567	missense	probably damaging	1.00
R7944:Ttc6	UTSW	12	57660443	missense	possibly damaging	0.46
R7945:Ttc6	UTSW	12	57660443	missense	possibly damaging	0.46
R7965:Ttc6	UTSW	12	57673756	missense	possibly damaging	0.85
R8062:Ttc6	UTSW	12	57736978	missense	possibly damaging	0.90
R8119:Ttc6	UTSW	12	57705643	missense	possibly damaging	0.78
R8142:Ttc6	UTSW	12	57697472	missense	possibly damaging	0.87
R8154:Ttc6	UTSW	12	57729424	missense	probably damaging	1.00
R8171:Ttc6	UTSW	12	57673310	missense	probably damaging	1.00
R8335:Ttc6	UTSW	12	57660291	missense	probably benign	0.00
R8343:Ttc6	UTSW	12	57660496	missense	possibly damaging	0.47
X0021:Ttc6	UTSW	12	57576118	missense	probably damaging	0.96
X0058:Ttc6	UTSW	12	57706851	missense	probably damaging	0.99
Z1176:Ttc6	UTSW	12	57697375	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- ACATGAGGGCAGAGCTTTTG -3'
(R):5'- GCTGCTATTCCTAGGAGACCTG -3'

Sequencing Primer
(F):5'- GTGTGCTCTGAGTTTTCTTTACC -3'
(R):5'- TCTTGGGAAGAGAGGAGAGGTTC -3'

Posted On

2016-07-06