Incidental Mutation 'R5257:Dcaf5'
ID399811
Institutional Source Beutler Lab
Gene Symbol Dcaf5
Ensembl Gene ENSMUSG00000049106
Gene NameDDB1 and CUL4 associated factor 5
SynonymsWdr22, 9430020B07Rik, BCRG2, BCRP2
MMRRC Submission 042855-MU
Accession Numbers

Genbank: NM_177267; MGI: 2444785

Is this an essential gene? Possibly non essential (E-score: 0.448) question?
Stock #R5257 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location80335848-80436601 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80397719 bp
ZygosityHeterozygous
Amino Acid Change Proline to Histidine at position 200 (P200H)
Ref Sequence ENSEMBL: ENSMUSP00000052755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054145]
Predicted Effect probably damaging
Transcript: ENSMUST00000054145
AA Change: P200H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052755
Gene: ENSMUSG00000049106
AA Change: P200H

DomainStartEndE-ValueType
WD40 42 82 3.32e-5 SMART
WD40 90 129 1.95e-2 SMART
WD40 132 171 1.28e-6 SMART
WD40 179 216 2.65e1 SMART
low complexity region 248 255 N/A INTRINSIC
WD40 264 308 1.66e0 SMART
WD40 322 361 2.01e-4 SMART
low complexity region 431 441 N/A INTRINSIC
low complexity region 506 518 N/A INTRINSIC
low complexity region 548 573 N/A INTRINSIC
low complexity region 623 638 N/A INTRINSIC
low complexity region 793 807 N/A INTRINSIC
low complexity region 929 941 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218498
Meta Mutation Damage Score 0.1744 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 97% (63/65)
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,249,684 T128S possibly damaging Het
Abca16 T G 7: 120,436,769 probably null Het
Acpp T C 9: 104,309,475 I266V probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Asf1b C T 8: 83,969,267 T179I probably benign Het
Astn1 A G 1: 158,612,532 K890R probably damaging Het
Card11 G A 5: 140,876,425 P1039L possibly damaging Het
Chsy3 A G 18: 59,409,794 E668G possibly damaging Het
Cnot8 T A 11: 58,117,522 N271K possibly damaging Het
Dkk4 C A 8: 22,627,015 L215I probably damaging Het
Dnhd1 C T 7: 105,674,037 T584I probably benign Het
Dock3 T C 9: 106,996,925 Y449C probably damaging Het
Dsg1a A G 18: 20,320,931 D31G probably damaging Het
Fgfr1op T C 17: 8,172,943 S152P probably benign Het
Foxi2 C T 7: 135,410,527 T48M probably benign Het
Gdf3 T C 6: 122,606,386 M341V probably damaging Het
Gm21738 A G 14: 19,415,942 L199S probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Igkv4-80 T A 6: 69,016,827 T27S probably benign Het
Ipo9 A T 1: 135,385,435 C1019S probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Ktn1 T A 14: 47,667,363 H199Q probably benign Het
Kyat3 A G 3: 142,734,576 M354V probably benign Het
Lbhd1 A G 19: 8,884,089 probably benign Het
Llgl1 G C 11: 60,711,563 probably null Het
Lyzl6 T A 11: 103,635,073 I74F probably damaging Het
Mfsd4b2 T A 10: 39,922,021 M113L probably benign Het
Mslnl T C 17: 25,746,165 Y502H probably benign Het
Nckap5 A G 1: 126,024,508 S1372P probably damaging Het
Nle1 T C 11: 82,904,946 D225G probably damaging Het
Olfr221 T C 14: 52,035,884 T76A possibly damaging Het
P2rx7 A G 5: 122,681,003 E496G probably damaging Het
Padi4 C T 4: 140,746,204 V641M probably benign Het
Phf11d T C 14: 59,352,711 I221V possibly damaging Het
Pla2g2c G A 4: 138,731,545 probably benign Het
Prdm16 A T 4: 154,367,214 D179E possibly damaging Het
Psca A T 15: 74,716,391 I56F probably damaging Het
Ptrhd1 A G 12: 4,236,481 Y124C probably damaging Het
Sardh T C 2: 27,244,259 T82A probably damaging Het
Sesn1 C T 10: 41,894,988 P172S probably benign Het
Setd4 T C 16: 93,596,333 T57A probably damaging Het
Skint5 T C 4: 113,577,662 T1037A unknown Het
Slc18a3 T C 14: 32,463,820 D202G probably damaging Het
Slc44a5 G A 3: 154,243,123 C176Y probably damaging Het
Slc6a5 G A 7: 49,929,992 V373M probably damaging Het
Sorbs3 T C 14: 70,185,034 I523V probably benign Het
Sspo T C 6: 48,476,494 V2872A probably damaging Het
Stard9 T A 2: 120,699,343 L2027H probably damaging Het
Tex2 T A 11: 106,567,759 probably benign Het
Tfdp1 C T 8: 13,369,529 T86M possibly damaging Het
Ttc6 A T 12: 57,702,275 D1331V possibly damaging Het
Vps13b A G 15: 35,794,421 T2326A possibly damaging Het
Wnk1 A G 6: 120,037,188 S149P probably benign Het
Zfp521 G A 18: 13,846,978 S126F probably damaging Het
Zfp958 A T 8: 4,628,456 E160D probably benign Het
Other mutations in Dcaf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Dcaf5 APN 12 80339323 missense probably benign 0.01
IGL00990:Dcaf5 APN 12 80338832 missense probably benign
IGL01788:Dcaf5 APN 12 80348324 missense probably damaging 1.00
IGL01865:Dcaf5 APN 12 80339314 missense probably benign 0.36
IGL02365:Dcaf5 APN 12 80398773 missense probably benign 0.01
R1160:Dcaf5 UTSW 12 80340215 missense possibly damaging 0.83
R1443:Dcaf5 UTSW 12 80364069 missense probably damaging 1.00
R1804:Dcaf5 UTSW 12 80339829 missense probably benign 0.19
R1945:Dcaf5 UTSW 12 80338694 missense probably benign 0.12
R2043:Dcaf5 UTSW 12 80340217 missense probably benign 0.03
R2104:Dcaf5 UTSW 12 80338861 missense probably benign 0.00
R4831:Dcaf5 UTSW 12 80339084 missense probably benign 0.00
R4860:Dcaf5 UTSW 12 80340232 missense probably benign 0.06
R4860:Dcaf5 UTSW 12 80340232 missense probably benign 0.06
R5263:Dcaf5 UTSW 12 80348346 missense probably damaging 1.00
R5569:Dcaf5 UTSW 12 80340201 missense probably damaging 1.00
R5597:Dcaf5 UTSW 12 80340043 missense probably damaging 0.99
R5632:Dcaf5 UTSW 12 80397752 missense probably damaging 0.98
R5779:Dcaf5 UTSW 12 80338832 missense probably benign
R5833:Dcaf5 UTSW 12 80348429 missense probably damaging 0.98
R6794:Dcaf5 UTSW 12 80398893 missense possibly damaging 0.66
R7188:Dcaf5 UTSW 12 80399958 missense probably damaging 1.00
R7238:Dcaf5 UTSW 12 80338709 missense probably benign 0.27
R7286:Dcaf5 UTSW 12 80348390 missense probably damaging 1.00
R7524:Dcaf5 UTSW 12 80376696 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGAGAAGCCCAACTGAGCTC -3'
(R):5'- GGAGACATGAAAGTTGGTACCTC -3'

Sequencing Primer
(F):5'- CACACAGCTACTCCACAAGTTCTTG -3'
(R):5'- CATGAAAGTTGGTACCTCATGGG -3'
Posted On2016-07-06