Incidental Mutation 'R0455:Fam13b'
ID 39984
Institutional Source Beutler Lab
Gene Symbol Fam13b
Ensembl Gene ENSMUSG00000036501
Gene Name family with sequence similarity 13, member B
Synonyms 2610024E20Rik
MMRRC Submission 038655-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock # R0455 (G1)
Quality Score 201
Status Validated
Chromosome 18
Chromosomal Location 34442352-34506823 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) G to A at 34445528 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014647] [ENSMUST00000040506] [ENSMUST00000166156]
AlphaFold Q8K2H3
Predicted Effect probably benign
Transcript: ENSMUST00000014647
SMART Domains Protein: ENSMUSP00000014647
Gene: ENSMUSG00000014503

DomainStartEndE-ValueType
transmembrane domain 32 51 N/A INTRINSIC
Pfam:PKD_channel 75 497 9.8e-129 PFAM
Pfam:Ion_trans 281 490 4.1e-19 PFAM
coiled coil region 523 550 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040506
SMART Domains Protein: ENSMUSP00000038199
Gene: ENSMUSG00000036501

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
RhoGAP 36 209 3.28e-44 SMART
coiled coil region 220 240 N/A INTRINSIC
low complexity region 280 295 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
coiled coil region 507 532 N/A INTRINSIC
low complexity region 719 726 N/A INTRINSIC
coiled coil region 778 807 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166156
SMART Domains Protein: ENSMUSP00000127257
Gene: ENSMUSG00000014503

DomainStartEndE-ValueType
transmembrane domain 32 51 N/A INTRINSIC
Pfam:PKD_channel 75 497 9.6e-131 PFAM
Pfam:Ion_trans 242 502 4.8e-20 PFAM
coiled coil region 523 550 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,230,983 G342D possibly damaging Het
Acvr2b C T 9: 119,432,609 R399W probably damaging Het
AI464131 G A 4: 41,499,538 R31* probably null Het
Atf6 A G 1: 170,834,923 V256A probably benign Het
Atp2b4 A T 1: 133,728,716 I732N probably damaging Het
C1qtnf9 A C 14: 60,772,371 Q25H probably damaging Het
Ccdc6 T A 10: 70,142,571 probably benign Het
Cds2 T C 2: 132,285,967 probably null Het
Chdh A G 14: 30,034,646 Y343C probably damaging Het
Col5a2 T C 1: 45,382,102 probably benign Het
Cts3 G A 13: 61,568,210 probably benign Het
Cyfip1 T A 7: 55,892,054 D362E probably benign Het
Dsg1b T A 18: 20,396,025 S273T probably benign Het
Dysf A T 6: 84,140,667 H1274L probably benign Het
Eva1c T C 16: 90,876,098 S187P probably benign Het
Fam126b T C 1: 58,534,479 probably benign Het
Fam172a T A 13: 77,834,713 probably benign Het
Fbn2 C T 18: 58,035,336 G2310S probably damaging Het
Fcna T C 2: 25,625,508 Y183C probably damaging Het
Fnta T C 8: 26,001,028 T263A probably benign Het
Gm94 T C 18: 43,781,244 D83G possibly damaging Het
Gnal C T 18: 67,135,649 probably benign Het
Grb7 T G 11: 98,452,188 S244A probably benign Het
Grm3 T C 5: 9,512,477 T458A probably benign Het
Hdac2 C T 10: 36,991,836 R193C probably damaging Het
Ighmbp2 T C 19: 3,265,072 R783G probably benign Het
Inpp5j G T 11: 3,503,122 L43I possibly damaging Het
Itga11 A T 9: 62,696,961 T44S probably damaging Het
Itsn1 C T 16: 91,868,148 probably benign Het
Kdm6b G T 11: 69,406,996 C233* probably null Het
Lamb3 T C 1: 193,343,392 L1130P probably damaging Het
Lrch3 T C 16: 32,986,880 F508L probably damaging Het
Lrrd1 T A 5: 3,866,425 V814E probably benign Het
Megf10 C T 18: 57,252,982 P356S probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Nus1 T A 10: 52,430,094 V42E probably damaging Het
Olfr435 A C 6: 43,202,072 M143L probably benign Het
Olfr739 A G 14: 50,424,902 I128V possibly damaging Het
Padi3 T C 4: 140,795,713 N306S probably damaging Het
Pex13 T C 11: 23,655,949 S94G probably benign Het
Ppm1h G T 10: 122,802,324 Q166H probably benign Het
Ptafr A T 4: 132,580,085 Y262F probably benign Het
Rabgap1 T A 2: 37,487,120 D321E probably damaging Het
Samsn1 C T 16: 75,945,225 noncoding transcript Het
Scarb1 T C 5: 125,289,681 N63D probably damaging Het
Serpinb7 T C 1: 107,451,610 I249T possibly damaging Het
Srpr A G 9: 35,214,981 K490R probably benign Het
Sycn A G 7: 28,540,973 N22D probably benign Het
Tarbp1 C T 8: 126,440,873 A1067T probably benign Het
Tex14 A G 11: 87,514,305 D681G possibly damaging Het
Usp34 C T 11: 23,446,741 probably benign Het
Vmn2r107 T C 17: 20,374,823 probably benign Het
Vwde A T 6: 13,187,529 M653K probably benign Het
Wrap73 T A 4: 154,148,743 S125T possibly damaging Het
Other mutations in Fam13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Fam13b APN 18 34487096 missense possibly damaging 0.92
IGL00402:Fam13b APN 18 34454718 missense probably damaging 1.00
IGL00556:Fam13b APN 18 34497435 missense probably damaging 0.99
IGL02123:Fam13b APN 18 34445618 unclassified probably benign
IGL02313:Fam13b APN 18 34454656 missense probably damaging 1.00
IGL02346:Fam13b APN 18 34462105 missense probably benign 0.00
IGL02347:Fam13b APN 18 34454704 missense probably damaging 1.00
IGL02694:Fam13b APN 18 34451206 critical splice donor site probably null
IGL03347:Fam13b APN 18 34462051 splice site probably benign
R0109:Fam13b UTSW 18 34451308 missense probably benign 0.00
R0233:Fam13b UTSW 18 34448084 missense probably damaging 1.00
R1229:Fam13b UTSW 18 34445583 missense probably benign 0.05
R1397:Fam13b UTSW 18 34445583 missense probably benign 0.05
R1571:Fam13b UTSW 18 34497432 missense possibly damaging 0.92
R1703:Fam13b UTSW 18 34451439 critical splice acceptor site probably null
R1732:Fam13b UTSW 18 34487134 missense probably benign 0.04
R1777:Fam13b UTSW 18 34457760 missense possibly damaging 0.84
R1956:Fam13b UTSW 18 34445329 missense possibly damaging 0.69
R2296:Fam13b UTSW 18 34494761 missense possibly damaging 0.88
R3881:Fam13b UTSW 18 34462059 critical splice donor site probably null
R3896:Fam13b UTSW 18 34462955 splice site probably benign
R5277:Fam13b UTSW 18 34462190 missense probably benign
R5759:Fam13b UTSW 18 34497435 missense probably damaging 0.99
R5817:Fam13b UTSW 18 34457797 missense possibly damaging 0.93
R5897:Fam13b UTSW 18 34454081 missense possibly damaging 0.83
R6009:Fam13b UTSW 18 34497405 missense possibly damaging 0.92
R6020:Fam13b UTSW 18 34494774 missense probably damaging 1.00
R6087:Fam13b UTSW 18 34487139 missense possibly damaging 0.48
R6151:Fam13b UTSW 18 34494277 missense probably damaging 0.96
R6454:Fam13b UTSW 18 34457662 critical splice donor site probably null
R6464:Fam13b UTSW 18 34473631 nonsense probably null
R6679:Fam13b UTSW 18 34487022 missense possibly damaging 0.53
R6723:Fam13b UTSW 18 34498026 missense possibly damaging 0.86
R6990:Fam13b UTSW 18 34497447 missense possibly damaging 0.92
R7420:Fam13b UTSW 18 34494611 missense probably damaging 1.00
R7517:Fam13b UTSW 18 34494607 missense probably damaging 0.98
R7534:Fam13b UTSW 18 34498007 missense probably damaging 0.97
R7889:Fam13b UTSW 18 34457691 missense probably benign 0.00
R8139:Fam13b UTSW 18 34473633 missense possibly damaging 0.50
R8776:Fam13b UTSW 18 34451393 missense probably damaging 1.00
R8776-TAIL:Fam13b UTSW 18 34451393 missense probably damaging 1.00
R8826:Fam13b UTSW 18 34498017 missense probably damaging 0.96
R9166:Fam13b UTSW 18 34462199 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGATAAGCAGAGATCCCGAGCCAG -3'
(R):5'- GGACTAAGCGCCCTATTAGGTGGAAG -3'

Sequencing Primer
(F):5'- AGAGATCCCGAGCCAGTTTTTC -3'
(R):5'- GCTGTTGTTACAGGGTTCTCCTT -3'
Posted On 2013-05-23