Incidental Mutation 'R5193:Tbc1d16'
ID399870
Institutional Source Beutler Lab
Gene Symbol Tbc1d16
Ensembl Gene ENSMUSG00000039976
Gene NameTBC1 domain family, member 16
Synonyms
MMRRC Submission 042769-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5193 (G1)
Quality Score214
Status Not validated
Chromosome11
Chromosomal Location119143045-119228499 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119158820 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 283 (D283E)
Ref Sequence ENSEMBL: ENSMUSP00000147182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036113] [ENSMUST00000207655]
Predicted Effect probably benign
Transcript: ENSMUST00000036113
AA Change: D283E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048516
Gene: ENSMUSG00000039976
AA Change: D283E

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
Blast:TBC 63 362 5e-75 BLAST
Blast:TBC 373 418 2e-13 BLAST
TBC 421 659 4.39e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183965
Predicted Effect probably benign
Transcript: ENSMUST00000207655
AA Change: D283E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 A T 2: 150,835,306 *56R probably null Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arfgap3 C T 15: 83,332,697 A156T probably benign Het
Bpifc T C 10: 86,000,633 T3A probably benign Het
Ccdc7a T A 8: 128,988,797 I269L probably benign Het
Cd151 A G 7: 141,470,693 Y253C probably damaging Het
Cenpl C A 1: 161,083,467 S328* probably null Het
Cfl1 T A 19: 5,492,552 V20D probably damaging Het
Clec14a A G 12: 58,268,614 L74P probably damaging Het
Cnn1 A T 9: 22,107,836 D196V probably damaging Het
Cst13 C A 2: 148,828,223 C104* probably null Het
Det1 A G 7: 78,843,554 V234A probably damaging Het
Efnb2 A G 8: 8,623,162 M165T probably damaging Het
Fbxo10 T A 4: 45,051,573 K339* probably null Het
Fnta A T 8: 26,011,218 probably null Het
Fsip2 A T 2: 82,982,994 Y3219F possibly damaging Het
Gm340 A G 19: 41,582,530 D54G probably damaging Het
Gprin2 C T 14: 34,194,875 V313M possibly damaging Het
Hars A G 18: 36,767,305 L448S possibly damaging Het
Hipk3 A G 2: 104,430,000 I1166T possibly damaging Het
Il31ra T C 13: 112,524,330 E602G probably benign Het
Kctd15 A G 7: 34,644,857 L123P probably damaging Het
Kif1bp T C 10: 62,559,396 D489G possibly damaging Het
Krt1 C A 15: 101,845,922 S631I unknown Het
Lancl1 T A 1: 67,021,014 Y84F probably benign Het
Mafa G T 15: 75,747,817 P36T unknown Het
Magi2 G A 5: 20,358,972 probably null Het
Mcm9 T A 10: 53,616,038 I396F probably damaging Het
Mrgprh T C 17: 12,877,055 F61L probably damaging Het
Olfr1 TAGCGGTCGTA T 11: 73,395,653 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1141 A T 2: 87,753,104 D296E possibly damaging Het
Olfr1511 A G 14: 52,390,612 W54R probably benign Het
Olfr576 T A 7: 102,965,936 F279I possibly damaging Het
Pcsk5 T A 19: 17,564,810 T806S possibly damaging Het
Pigc T C 1: 161,970,896 I149T possibly damaging Het
Pou5f2 C A 13: 78,024,964 N8K probably benign Het
Pou6f2 T C 13: 18,125,544 probably benign Het
Prl3d2 T A 13: 27,122,329 M13K possibly damaging Het
Pzp T C 6: 128,502,334 N619D probably benign Het
Rnps1 G A 17: 24,418,543 S53N probably benign Het
Scaf8 C G 17: 3,190,165 A604G probably benign Het
Scn10a T C 9: 119,609,655 N1716S probably damaging Het
Slc17a2 A G 13: 23,819,862 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Syne2 A G 12: 76,094,420 D6102G probably damaging Het
Tet1 T C 10: 62,838,247 D1350G probably benign Het
Trpa1 A G 1: 14,875,917 Y997H possibly damaging Het
Tyro3 T C 2: 119,810,517 L494P probably damaging Het
Uba6 G T 5: 86,124,422 Q803K probably benign Het
Vgll2 T A 10: 52,027,992 L317Q possibly damaging Het
Wdr62 A T 7: 30,265,167 I384N probably damaging Het
Wdtc1 G A 4: 133,294,367 R619* probably null Het
Xkr6 A G 14: 63,818,907 D89G possibly damaging Het
Other mutations in Tbc1d16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01930:Tbc1d16 APN 11 119156075 missense possibly damaging 0.69
IGL01973:Tbc1d16 APN 11 119156707 missense probably benign 0.19
IGL02456:Tbc1d16 APN 11 119210546 missense probably damaging 1.00
H8441:Tbc1d16 UTSW 11 119149014 nonsense probably null
R0118:Tbc1d16 UTSW 11 119157816 missense probably damaging 1.00
R0255:Tbc1d16 UTSW 11 119147575 missense possibly damaging 0.94
R0330:Tbc1d16 UTSW 11 119158729 critical splice donor site probably null
R0620:Tbc1d16 UTSW 11 119209038 missense probably benign 0.04
R1502:Tbc1d16 UTSW 11 119154004 missense probably damaging 1.00
R1806:Tbc1d16 UTSW 11 119156101 missense probably damaging 1.00
R2163:Tbc1d16 UTSW 11 119155078 splice site probably benign
R2897:Tbc1d16 UTSW 11 119157828 missense probably damaging 0.97
R2898:Tbc1d16 UTSW 11 119157828 missense probably damaging 0.97
R4454:Tbc1d16 UTSW 11 119157873 missense possibly damaging 0.86
R5465:Tbc1d16 UTSW 11 119156059 missense probably benign
R5478:Tbc1d16 UTSW 11 119155091 missense probably benign 0.07
R5642:Tbc1d16 UTSW 11 119158791 missense probably damaging 0.98
R5721:Tbc1d16 UTSW 11 119158730 critical splice donor site probably null
R6195:Tbc1d16 UTSW 11 119210565 nonsense probably null
R6233:Tbc1d16 UTSW 11 119210565 nonsense probably null
R6596:Tbc1d16 UTSW 11 119157775 missense probably damaging 1.00
R6932:Tbc1d16 UTSW 11 119208916 missense probably damaging 1.00
R7023:Tbc1d16 UTSW 11 119158791 missense probably damaging 0.98
R7262:Tbc1d16 UTSW 11 119155095 missense probably benign 0.00
R8006:Tbc1d16 UTSW 11 119156072 missense probably damaging 0.96
R8506:Tbc1d16 UTSW 11 119148958 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGAAATGCACATGGCTGCG -3'
(R):5'- ATCGTTCACTGACACCTGG -3'

Sequencing Primer
(F):5'- CACATGGCTGCGTGTGC -3'
(R):5'- TTCACTGACACCTGGGTCGC -3'
Posted On2016-07-06