Incidental Mutation 'R5268:Mbd5'
ID399871
Institutional Source Beutler Lab
Gene Symbol Mbd5
Ensembl Gene ENSMUSG00000036792
Gene Namemethyl-CpG binding domain protein 5
SynonymsC030040A15Rik, OTTMUSG00000012483, 9430004D19Rik
MMRRC Submission 042860-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5268 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location48949508-49325405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49272094 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 863 (I863F)
Ref Sequence ENSEMBL: ENSMUSP00000036847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047413] [ENSMUST00000112754] [ENSMUST00000132717]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047413
AA Change: I863F

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036847
Gene: ENSMUSG00000036792
AA Change: I863F

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Blast:MBD 24 77 9e-11 BLAST
low complexity region 332 342 N/A INTRINSIC
low complexity region 429 443 N/A INTRINSIC
low complexity region 459 467 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
low complexity region 535 546 N/A INTRINSIC
low complexity region 571 613 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
low complexity region 912 932 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
low complexity region 992 1010 N/A INTRINSIC
low complexity region 1020 1035 N/A INTRINSIC
low complexity region 1112 1136 N/A INTRINSIC
low complexity region 1173 1184 N/A INTRINSIC
low complexity region 1206 1229 N/A INTRINSIC
low complexity region 1552 1562 N/A INTRINSIC
SCOP:d1khca_ 1615 1718 2e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112754
AA Change: I863F

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108374
Gene: ENSMUSG00000036792
AA Change: I863F

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Blast:MBD 24 77 8e-11 BLAST
low complexity region 332 342 N/A INTRINSIC
low complexity region 429 443 N/A INTRINSIC
low complexity region 459 467 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
low complexity region 535 546 N/A INTRINSIC
low complexity region 571 613 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
low complexity region 912 932 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
low complexity region 976 999 N/A INTRINSIC
low complexity region 1322 1332 N/A INTRINSIC
SCOP:d1khca_ 1385 1488 4e-17 SMART
Predicted Effect unknown
Transcript: ENSMUST00000122841
AA Change: I602F
SMART Domains Protein: ENSMUSP00000119317
Gene: ENSMUSG00000036792
AA Change: I602F

DomainStartEndE-ValueType
low complexity region 72 82 N/A INTRINSIC
low complexity region 169 183 N/A INTRINSIC
low complexity region 199 207 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
low complexity region 275 286 N/A INTRINSIC
low complexity region 311 353 N/A INTRINSIC
low complexity region 439 459 N/A INTRINSIC
low complexity region 581 592 N/A INTRINSIC
low complexity region 652 672 N/A INTRINSIC
low complexity region 674 688 N/A INTRINSIC
low complexity region 732 750 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 852 876 N/A INTRINSIC
low complexity region 913 924 N/A INTRINSIC
low complexity region 946 969 N/A INTRINSIC
low complexity region 1011 1022 N/A INTRINSIC
low complexity region 1056 1064 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132717
SMART Domains Protein: ENSMUSP00000137021
Gene: ENSMUSG00000036792

DomainStartEndE-ValueType
low complexity region 20 40 N/A INTRINSIC
low complexity region 42 56 N/A INTRINSIC
low complexity region 100 118 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
low complexity region 220 244 N/A INTRINSIC
low complexity region 281 292 N/A INTRINSIC
low complexity region 314 337 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
low complexity region 424 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199257
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the methyl-CpG-binding domain (MBD) family. The MBD consists of about 70 residues and is the minimal region required for a methyl-CpG-binding protein binding specifically to methylated DNA. In addition to the MBD domain, this protein contains a PWWP domain (Pro-Trp-Trp-Pro motif), which consists of 100-150 amino acids and is found in numerous proteins that are involved in cell division, growth and differentiation. Mutations in this gene cause mental retardation autosomal dominant type 1. Haploinsufficiency of this gene is associated with a syndrome involving microcephaly, intellectual disabilities, severe speech impairment, and seizures. Alternatively spliced transcript variants have been found, but their full-length nature is not determined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozgyous for a knock-out allele exhibit severe postnatal growth retardation leading to lethality by P22, decreased body, brain and liver weights, reduced IGF-I and GH levels, and abnormal glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810032O08Rik G T 11: 116,671,756 M18I probably benign Het
Adamtsl4 C A 3: 95,680,163 R701L probably damaging Het
Adgrf5 T C 17: 43,450,999 V1195A probably damaging Het
Agpat5 A G 8: 18,881,862 T333A possibly damaging Het
Aspm G T 1: 139,464,295 G795C probably damaging Het
Car4 C A 11: 84,965,800 Q305K probably benign Het
Catsperg1 T C 7: 29,195,247 N612S probably benign Het
Cdc5l G A 17: 45,415,585 R354W probably damaging Het
Cdh9 G A 15: 16,851,013 V623I probably benign Het
Cfap65 A G 1: 74,924,902 V629A probably benign Het
Chd1 G A 17: 15,735,743 V535I probably damaging Het
Col12a1 A G 9: 79,678,047 V1316A probably damaging Het
Col6a3 A T 1: 90,785,243 D1721E unknown Het
Cop1 T A 1: 159,327,164 F647L probably damaging Het
Corin A C 5: 72,343,019 S421A probably damaging Het
Crb2 T C 2: 37,790,821 V587A probably damaging Het
Ctc1 T A 11: 69,029,810 V646E possibly damaging Het
Cyp2a12 A T 7: 27,031,218 M203L probably benign Het
Dcdc2c T A 12: 28,516,657 K336M possibly damaging Het
Ddx39 G A 8: 83,722,321 R275H probably benign Het
Des A G 1: 75,362,928 N310S possibly damaging Het
Dlk1 C A 12: 109,459,838 S212R probably benign Het
Dnajc5b A G 3: 19,579,060 E149G probably benign Het
Dpep1 A T 8: 123,194,089 I3F probably benign Het
Eml6 T A 11: 29,803,108 R934S probably benign Het
Ercc6l2 T C 13: 63,869,111 L676P possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Frem2 T A 3: 53,653,154 I1311F probably damaging Het
Gldc T A 19: 30,145,725 M257L probably damaging Het
Gm5538 A G 3: 59,752,023 E299G probably damaging Het
Gm8674 T G 13: 49,901,354 noncoding transcript Het
Gnai3 C T 3: 108,123,541 probably null Het
Gtf3a A G 5: 146,955,155 D300G probably damaging Het
Haus3 A T 5: 34,166,105 V387D probably damaging Het
Hpf1 T A 8: 60,893,734 F28I possibly damaging Het
Iars A G 13: 49,690,491 D147G probably damaging Het
Ibtk A T 9: 85,743,690 D2E probably benign Het
Ift140 T A 17: 25,020,627 I86K possibly damaging Het
Igf2bp2 T A 16: 22,079,491 I235F probably damaging Het
Ighv3-8 G T 12: 114,322,632 A30E probably benign Het
Kcnq5 T A 1: 21,505,725 T252S probably damaging Het
Lrrc4b A T 7: 44,461,363 N220Y probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mamdc4 T C 2: 25,564,690 T1037A possibly damaging Het
Muc4 T A 16: 32,751,666 S515T possibly damaging Het
Mylk4 T A 13: 32,708,881 probably null Het
Neu4 G A 1: 94,024,947 R346H probably benign Het
Nxpe5 T A 5: 138,239,938 Y253* probably null Het
Olfml2b A T 1: 170,649,761 E155V probably damaging Het
Olfr160 T A 9: 37,712,004 I92F probably damaging Het
Olfr2 T A 7: 107,000,904 N319Y probably benign Het
Olfr304 A G 7: 86,385,659 *334Q probably null Het
Pamr1 G A 2: 102,586,684 A114T probably damaging Het
Pdzd2 T A 15: 12,592,177 N127I probably damaging Het
Pglyrp4 C T 3: 90,726,964 L5F probably damaging Het
Plce1 T A 19: 38,758,835 S1667T possibly damaging Het
Qser1 A T 2: 104,787,431 V1012E possibly damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rcn3 A T 7: 45,086,779 D168E probably damaging Het
Rdh1 T G 10: 127,759,963 V9G possibly damaging Het
Rin2 A G 2: 145,844,760 T70A probably benign Het
Rnf207 T C 4: 152,313,889 D276G probably damaging Het
Rtel1 C T 2: 181,340,561 S368L probably benign Het
Slc15a5 C A 6: 138,079,753 C55F probably damaging Het
Slc36a4 T C 9: 15,726,916 F213L possibly damaging Het
Spata25 C T 2: 164,828,034 G19D probably damaging Het
St5 A G 7: 109,557,312 L77P probably benign Het
Tas2r102 A T 6: 132,762,397 L89F probably damaging Het
Tbc1d1 A G 5: 64,324,567 K704E probably damaging Het
Tert T G 13: 73,627,354 S75A probably damaging Het
Tiparp T A 3: 65,547,565 L195Q possibly damaging Het
Tmem205 A C 9: 21,926,084 Y57* probably null Het
Tomm22 A G 15: 79,671,227 R5G probably benign Het
Trav10 A T 14: 53,506,058 S39C probably benign Het
Trav6-2 T A 14: 52,667,748 N75K probably benign Het
Trio T C 15: 27,748,286 S2427G probably benign Het
Ttc41 C A 10: 86,744,478 H763N possibly damaging Het
Usp29 A T 7: 6,961,584 N142I probably damaging Het
Vmn1r204 G T 13: 22,556,742 W181L probably damaging Het
Vmn2r76 G A 7: 86,226,059 T570M probably damaging Het
Wdr90 A G 17: 25,850,845 L1173P probably damaging Het
Wnt9a T A 11: 59,328,570 C141S probably damaging Het
Zfp462 A T 4: 55,012,299 I1422L probably benign Het
Other mutations in Mbd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Mbd5 APN 2 49250221 missense possibly damaging 0.92
IGL01481:Mbd5 APN 2 49278939 missense possibly damaging 0.90
IGL01639:Mbd5 APN 2 49272308 missense probably damaging 0.98
IGL02063:Mbd5 APN 2 49274767 missense probably damaging 1.00
IGL02157:Mbd5 APN 2 49278975 missense probably benign
IGL02510:Mbd5 APN 2 49257029 missense probably benign 0.05
IGL02932:Mbd5 APN 2 49279448 missense possibly damaging 0.66
IGL02973:Mbd5 APN 2 49313709 missense probably damaging 0.99
IGL03189:Mbd5 APN 2 49257751 missense probably damaging 0.98
F5770:Mbd5 UTSW 2 49316410 missense probably damaging 0.99
R0391:Mbd5 UTSW 2 49272416 missense possibly damaging 0.90
R0427:Mbd5 UTSW 2 49279079 missense probably benign 0.27
R0544:Mbd5 UTSW 2 49257209 missense possibly damaging 0.54
R0883:Mbd5 UTSW 2 49256689 missense possibly damaging 0.94
R1072:Mbd5 UTSW 2 49257191 missense probably damaging 1.00
R1099:Mbd5 UTSW 2 49258144 missense probably benign 0.06
R1400:Mbd5 UTSW 2 49274776 critical splice donor site probably null
R1497:Mbd5 UTSW 2 49257381 missense possibly damaging 0.73
R1552:Mbd5 UTSW 2 49272934 missense probably damaging 0.99
R1675:Mbd5 UTSW 2 49256218 missense possibly damaging 0.90
R1710:Mbd5 UTSW 2 49257032 missense probably benign 0.10
R2085:Mbd5 UTSW 2 49279311 missense possibly damaging 0.90
R2252:Mbd5 UTSW 2 49257686 missense probably damaging 1.00
R2473:Mbd5 UTSW 2 49279341 missense probably benign 0.06
R3966:Mbd5 UTSW 2 49272070 missense possibly damaging 0.46
R4278:Mbd5 UTSW 2 49272293 missense probably damaging 0.97
R4348:Mbd5 UTSW 2 49256327 missense probably benign
R4366:Mbd5 UTSW 2 49272966 missense probably damaging 0.99
R4428:Mbd5 UTSW 2 49279764 missense possibly damaging 0.94
R4556:Mbd5 UTSW 2 49279394 missense probably damaging 1.00
R4600:Mbd5 UTSW 2 49257197 missense probably benign 0.31
R4689:Mbd5 UTSW 2 49258279 missense possibly damaging 0.46
R4707:Mbd5 UTSW 2 49250156 missense probably damaging 0.99
R4718:Mbd5 UTSW 2 49256402 missense possibly damaging 0.66
R4773:Mbd5 UTSW 2 49274611 missense probably damaging 1.00
R4846:Mbd5 UTSW 2 49256997 missense probably damaging 1.00
R5015:Mbd5 UTSW 2 49258196 missense possibly damaging 0.92
R5059:Mbd5 UTSW 2 49256455 missense probably damaging 0.96
R5479:Mbd5 UTSW 2 49272905 missense probably damaging 0.99
R5579:Mbd5 UTSW 2 49272814 missense possibly damaging 0.94
R5591:Mbd5 UTSW 2 49274669 missense probably damaging 1.00
R5876:Mbd5 UTSW 2 49274645 missense probably damaging 0.98
R5886:Mbd5 UTSW 2 49272452 missense probably damaging 1.00
R5973:Mbd5 UTSW 2 49272389 missense probably benign 0.23
R6935:Mbd5 UTSW 2 49279812 missense probably damaging 0.97
R7317:Mbd5 UTSW 2 49279743 missense probably benign
R7366:Mbd5 UTSW 2 49274568 missense probably benign
R7385:Mbd5 UTSW 2 49272449 missense probably benign 0.01
R7402:Mbd5 UTSW 2 49257554 missense probably damaging 1.00
R7462:Mbd5 UTSW 2 49257880 missense possibly damaging 0.52
R7549:Mbd5 UTSW 2 49251343 missense probably damaging 0.97
V7583:Mbd5 UTSW 2 49316410 missense probably damaging 0.99
Z1176:Mbd5 UTSW 2 49279308 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCAGCAAACGTCGTCAGAC -3'
(R):5'- GTTGATTCACTGGCAAAGAGATAGG -3'

Sequencing Primer
(F):5'- ATGTTGCTAACGGTCCA -3'
(R):5'- CTGAGGAGGCTGGGGTTCAAG -3'
Posted On2016-07-06