Incidental Mutation 'R5193:Rnps1'
ID399901
Institutional Source Beutler Lab
Gene Symbol Rnps1
Ensembl Gene ENSMUSG00000034681
Gene Nameribonucleic acid binding protein S1
Synonyms
MMRRC Submission 042769-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5193 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24414675-24425895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24418543 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 53 (S53N)
Ref Sequence ENSEMBL: ENSMUSP00000126345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088512] [ENSMUST00000115371] [ENSMUST00000163717]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084725
Predicted Effect probably benign
Transcript: ENSMUST00000088512
AA Change: S53N

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000085867
Gene: ENSMUSG00000034681
AA Change: S53N

DomainStartEndE-ValueType
low complexity region 30 46 N/A INTRINSIC
low complexity region 55 157 N/A INTRINSIC
RRM 162 236 5.12e-21 SMART
low complexity region 243 305 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000115371
AA Change: S30N
SMART Domains Protein: ENSMUSP00000111028
Gene: ENSMUSG00000034681
AA Change: S30N

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 32 134 N/A INTRINSIC
RRM 139 213 5.12e-21 SMART
low complexity region 220 282 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163717
AA Change: S53N

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126345
Gene: ENSMUSG00000034681
AA Change: S53N

DomainStartEndE-ValueType
low complexity region 30 46 N/A INTRINSIC
low complexity region 55 157 N/A INTRINSIC
RRM 162 236 5.12e-21 SMART
low complexity region 243 305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181760
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein binds to the mRNA and remains bound after nuclear export, acting as a nucleocytoplasmic shuttling protein. This protein contains many serine residues. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 A T 2: 150,835,306 *56R probably null Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arfgap3 C T 15: 83,332,697 A156T probably benign Het
Bpifc T C 10: 86,000,633 T3A probably benign Het
Ccdc7a T A 8: 128,988,797 I269L probably benign Het
Cd151 A G 7: 141,470,693 Y253C probably damaging Het
Cenpl C A 1: 161,083,467 S328* probably null Het
Cfl1 T A 19: 5,492,552 V20D probably damaging Het
Clec14a A G 12: 58,268,614 L74P probably damaging Het
Cnn1 A T 9: 22,107,836 D196V probably damaging Het
Cst13 C A 2: 148,828,223 C104* probably null Het
Det1 A G 7: 78,843,554 V234A probably damaging Het
Efnb2 A G 8: 8,623,162 M165T probably damaging Het
Fbxo10 T A 4: 45,051,573 K339* probably null Het
Fnta A T 8: 26,011,218 probably null Het
Fsip2 A T 2: 82,982,994 Y3219F possibly damaging Het
Gm340 A G 19: 41,582,530 D54G probably damaging Het
Gprin2 C T 14: 34,194,875 V313M possibly damaging Het
Hars A G 18: 36,767,305 L448S possibly damaging Het
Hipk3 A G 2: 104,430,000 I1166T possibly damaging Het
Il31ra T C 13: 112,524,330 E602G probably benign Het
Kctd15 A G 7: 34,644,857 L123P probably damaging Het
Kif1bp T C 10: 62,559,396 D489G possibly damaging Het
Krt1 C A 15: 101,845,922 S631I unknown Het
Lancl1 T A 1: 67,021,014 Y84F probably benign Het
Mafa G T 15: 75,747,817 P36T unknown Het
Magi2 G A 5: 20,358,972 probably null Het
Mcm9 T A 10: 53,616,038 I396F probably damaging Het
Mrgprh T C 17: 12,877,055 F61L probably damaging Het
Olfr1 TAGCGGTCGTA T 11: 73,395,653 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1141 A T 2: 87,753,104 D296E possibly damaging Het
Olfr1511 A G 14: 52,390,612 W54R probably benign Het
Olfr576 T A 7: 102,965,936 F279I possibly damaging Het
Pcsk5 T A 19: 17,564,810 T806S possibly damaging Het
Pigc T C 1: 161,970,896 I149T possibly damaging Het
Pou5f2 C A 13: 78,024,964 N8K probably benign Het
Pou6f2 T C 13: 18,125,544 probably benign Het
Prl3d2 T A 13: 27,122,329 M13K possibly damaging Het
Pzp T C 6: 128,502,334 N619D probably benign Het
Scaf8 C G 17: 3,190,165 A604G probably benign Het
Scn10a T C 9: 119,609,655 N1716S probably damaging Het
Slc17a2 A G 13: 23,819,862 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Syne2 A G 12: 76,094,420 D6102G probably damaging Het
Tbc1d16 A T 11: 119,158,820 D283E probably benign Het
Tet1 T C 10: 62,838,247 D1350G probably benign Het
Trpa1 A G 1: 14,875,917 Y997H possibly damaging Het
Tyro3 T C 2: 119,810,517 L494P probably damaging Het
Uba6 G T 5: 86,124,422 Q803K probably benign Het
Vgll2 T A 10: 52,027,992 L317Q possibly damaging Het
Wdr62 A T 7: 30,265,167 I384N probably damaging Het
Wdtc1 G A 4: 133,294,367 R619* probably null Het
Xkr6 A G 14: 63,818,907 D89G possibly damaging Het
Other mutations in Rnps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Rnps1 APN 17 24422299 missense probably damaging 1.00
IGL01433:Rnps1 APN 17 24424545 critical splice donor site probably null
IGL01984:Rnps1 APN 17 24424397 splice site probably benign
IGL03410:Rnps1 APN 17 24421861 splice site probably benign
unbalanced UTSW 17 24422168 missense probably damaging 1.00
R0594:Rnps1 UTSW 17 24424437 missense probably damaging 0.99
R1397:Rnps1 UTSW 17 24412057 unclassified probably benign
R1938:Rnps1 UTSW 17 24420390 missense unknown
R2321:Rnps1 UTSW 17 24422168 missense probably damaging 1.00
R3085:Rnps1 UTSW 17 24412419 unclassified probably benign
R3086:Rnps1 UTSW 17 24412419 unclassified probably benign
R4296:Rnps1 UTSW 17 24425115 unclassified probably benign
R5159:Rnps1 UTSW 17 24418512 missense unknown
R5753:Rnps1 UTSW 17 24418164 intron probably benign
R7378:Rnps1 UTSW 17 24418530 missense unknown
R7403:Rnps1 UTSW 17 24425087 missense unknown
R7690:Rnps1 UTSW 17 24418194 missense unknown
R8104:Rnps1 UTSW 17 24424510 missense unknown
Predicted Primers PCR Primer
(F):5'- CTACAGTGCGTGCCCTAATTC -3'
(R):5'- ACTTTTGGCCTTCACAACAC -3'

Sequencing Primer
(F):5'- GTGCGTGCCCTAATTCACAGATG -3'
(R):5'- TTTTGGCCTTCACAACACACACG -3'
Posted On2016-07-06