Incidental Mutation 'R5268:Haus3'
ID399902
Institutional Source Beutler Lab
Gene Symbol Haus3
Ensembl Gene ENSMUSG00000079555
Gene NameHAUS augmin-like complex, subunit 3
SynonymsD5H4S43, D4S43h, D5H4S43E
MMRRC Submission 042860-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5268 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location34153880-34169527 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34166105 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 387 (V387D)
Ref Sequence ENSEMBL: ENSMUSP00000049973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042954] [ENSMUST00000060049] [ENSMUST00000202042] [ENSMUST00000202409] [ENSMUST00000202541] [ENSMUST00000202638]
Predicted Effect probably benign
Transcript: ENSMUST00000042954
SMART Domains Protein: ENSMUSP00000036110
Gene: ENSMUSG00000045102

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
POLAc 605 814 7.88e-67 SMART
low complexity region 829 843 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000060049
AA Change: V387D

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049973
Gene: ENSMUSG00000079555
AA Change: V387D

DomainStartEndE-ValueType
Pfam:HAUS-augmin3 29 282 4.8e-85 PFAM
coiled coil region 294 336 N/A INTRINSIC
coiled coil region 459 495 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201069
Predicted Effect probably benign
Transcript: ENSMUST00000202042
SMART Domains Protein: ENSMUSP00000144049
Gene: ENSMUSG00000079555

DomainStartEndE-ValueType
Pfam:HAUS-augmin3 29 96 7.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202290
Predicted Effect probably benign
Transcript: ENSMUST00000202409
SMART Domains Protein: ENSMUSP00000144578
Gene: ENSMUSG00000045102

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
coiled coil region 448 471 N/A INTRINSIC
POLAc 587 796 2.6e-69 SMART
low complexity region 811 825 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202541
Predicted Effect probably benign
Transcript: ENSMUST00000202638
SMART Domains Protein: ENSMUSP00000143793
Gene: ENSMUSG00000045102

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
coiled coil region 448 471 N/A INTRINSIC
POLAc 605 770 3e-37 SMART
low complexity region 785 799 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the HAUS augmin-like protein complex, which plays a key role in cytokinesis and mitosis. Disruption of the encoded protein causes mitotic defects resulting from fragmentation of centrosomes and microtubule destabilization. This gene shares its 5' exons with some transcripts from overlapping GeneID: 353497, which encodes a DNA polymerase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit pre- or peri-implantation lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810032O08Rik G T 11: 116,671,756 M18I probably benign Het
Adamtsl4 C A 3: 95,680,163 R701L probably damaging Het
Adgrf5 T C 17: 43,450,999 V1195A probably damaging Het
Agpat5 A G 8: 18,881,862 T333A possibly damaging Het
Aspm G T 1: 139,464,295 G795C probably damaging Het
Car4 C A 11: 84,965,800 Q305K probably benign Het
Catsperg1 T C 7: 29,195,247 N612S probably benign Het
Cdc5l G A 17: 45,415,585 R354W probably damaging Het
Cdh9 G A 15: 16,851,013 V623I probably benign Het
Cfap65 A G 1: 74,924,902 V629A probably benign Het
Chd1 G A 17: 15,735,743 V535I probably damaging Het
Col12a1 A G 9: 79,678,047 V1316A probably damaging Het
Col6a3 A T 1: 90,785,243 D1721E unknown Het
Cop1 T A 1: 159,327,164 F647L probably damaging Het
Corin A C 5: 72,343,019 S421A probably damaging Het
Crb2 T C 2: 37,790,821 V587A probably damaging Het
Ctc1 T A 11: 69,029,810 V646E possibly damaging Het
Cyp2a12 A T 7: 27,031,218 M203L probably benign Het
Dcdc2c T A 12: 28,516,657 K336M possibly damaging Het
Ddx39 G A 8: 83,722,321 R275H probably benign Het
Des A G 1: 75,362,928 N310S possibly damaging Het
Dlk1 C A 12: 109,459,838 S212R probably benign Het
Dnajc5b A G 3: 19,579,060 E149G probably benign Het
Dpep1 A T 8: 123,194,089 I3F probably benign Het
Eml6 T A 11: 29,803,108 R934S probably benign Het
Ercc6l2 T C 13: 63,869,111 L676P possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Frem2 T A 3: 53,653,154 I1311F probably damaging Het
Gldc T A 19: 30,145,725 M257L probably damaging Het
Gm5538 A G 3: 59,752,023 E299G probably damaging Het
Gm8674 T G 13: 49,901,354 noncoding transcript Het
Gnai3 C T 3: 108,123,541 probably null Het
Gtf3a A G 5: 146,955,155 D300G probably damaging Het
Hpf1 T A 8: 60,893,734 F28I possibly damaging Het
Iars A G 13: 49,690,491 D147G probably damaging Het
Ibtk A T 9: 85,743,690 D2E probably benign Het
Ift140 T A 17: 25,020,627 I86K possibly damaging Het
Igf2bp2 T A 16: 22,079,491 I235F probably damaging Het
Ighv3-8 G T 12: 114,322,632 A30E probably benign Het
Kcnq5 T A 1: 21,505,725 T252S probably damaging Het
Lrrc4b A T 7: 44,461,363 N220Y probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mamdc4 T C 2: 25,564,690 T1037A possibly damaging Het
Mbd5 A T 2: 49,272,094 I863F possibly damaging Het
Muc4 T A 16: 32,751,666 S515T possibly damaging Het
Mylk4 T A 13: 32,708,881 probably null Het
Neu4 G A 1: 94,024,947 R346H probably benign Het
Nxpe5 T A 5: 138,239,938 Y253* probably null Het
Olfml2b A T 1: 170,649,761 E155V probably damaging Het
Olfr160 T A 9: 37,712,004 I92F probably damaging Het
Olfr2 T A 7: 107,000,904 N319Y probably benign Het
Olfr304 A G 7: 86,385,659 *334Q probably null Het
Pamr1 G A 2: 102,586,684 A114T probably damaging Het
Pdzd2 T A 15: 12,592,177 N127I probably damaging Het
Pglyrp4 C T 3: 90,726,964 L5F probably damaging Het
Plce1 T A 19: 38,758,835 S1667T possibly damaging Het
Qser1 A T 2: 104,787,431 V1012E possibly damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rcn3 A T 7: 45,086,779 D168E probably damaging Het
Rdh1 T G 10: 127,759,963 V9G possibly damaging Het
Rin2 A G 2: 145,844,760 T70A probably benign Het
Rnf207 T C 4: 152,313,889 D276G probably damaging Het
Rtel1 C T 2: 181,340,561 S368L probably benign Het
Slc15a5 C A 6: 138,079,753 C55F probably damaging Het
Slc36a4 T C 9: 15,726,916 F213L possibly damaging Het
Spata25 C T 2: 164,828,034 G19D probably damaging Het
St5 A G 7: 109,557,312 L77P probably benign Het
Tas2r102 A T 6: 132,762,397 L89F probably damaging Het
Tbc1d1 A G 5: 64,324,567 K704E probably damaging Het
Tert T G 13: 73,627,354 S75A probably damaging Het
Tiparp T A 3: 65,547,565 L195Q possibly damaging Het
Tmem205 A C 9: 21,926,084 Y57* probably null Het
Tomm22 A G 15: 79,671,227 R5G probably benign Het
Trav10 A T 14: 53,506,058 S39C probably benign Het
Trav6-2 T A 14: 52,667,748 N75K probably benign Het
Trio T C 15: 27,748,286 S2427G probably benign Het
Ttc41 C A 10: 86,744,478 H763N possibly damaging Het
Usp29 A T 7: 6,961,584 N142I probably damaging Het
Vmn1r204 G T 13: 22,556,742 W181L probably damaging Het
Vmn2r76 G A 7: 86,226,059 T570M probably damaging Het
Wdr90 A G 17: 25,850,845 L1173P probably damaging Het
Wnt9a T A 11: 59,328,570 C141S probably damaging Het
Zfp462 A T 4: 55,012,299 I1422L probably benign Het
Other mutations in Haus3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Haus3 APN 5 34167928 missense probably benign 0.00
IGL00990:Haus3 APN 5 34166346 missense probably benign 0.00
IGL01311:Haus3 APN 5 34167644 nonsense probably null
IGL01906:Haus3 APN 5 34168323 intron probably benign
IGL01964:Haus3 APN 5 34166061 missense probably benign 0.19
IGL02383:Haus3 APN 5 34166236 nonsense probably null
IGL02584:Haus3 APN 5 34166258 nonsense probably null
IGL02800:Haus3 APN 5 34166324 missense possibly damaging 0.94
IGL03010:Haus3 APN 5 34166287 missense probably benign 0.04
IGL03371:Haus3 APN 5 34166343 nonsense probably null
R0102:Haus3 UTSW 5 34165914 critical splice donor site probably null
R0102:Haus3 UTSW 5 34165914 critical splice donor site probably null
R0238:Haus3 UTSW 5 34166256 missense possibly damaging 0.54
R0238:Haus3 UTSW 5 34166256 missense possibly damaging 0.54
R0701:Haus3 UTSW 5 34166015 missense probably benign 0.05
R1527:Haus3 UTSW 5 34154053 missense probably benign 0.00
R1714:Haus3 UTSW 5 34163697 missense probably benign 0.03
R1800:Haus3 UTSW 5 34163572 missense probably damaging 1.00
R4874:Haus3 UTSW 5 34167628 missense probably benign 0.07
R4895:Haus3 UTSW 5 34168070 missense probably benign 0.33
R5613:Haus3 UTSW 5 34167829 missense probably damaging 0.98
R6299:Haus3 UTSW 5 34167796 missense probably benign 0.40
R6701:Haus3 UTSW 5 34167734 missense probably damaging 0.99
R7414:Haus3 UTSW 5 34166133 missense probably benign
R7920:Haus3 UTSW 5 34167702 missense probably benign 0.04
R8273:Haus3 UTSW 5 34154091 missense probably benign 0.00
X0019:Haus3 UTSW 5 34163556 nonsense probably null
X0063:Haus3 UTSW 5 34166222 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- ACCTATGAGTGGAATGATCTTTGG -3'
(R):5'- TTCAGTAGTTCATGCTGGCC -3'

Sequencing Primer
(F):5'- ATCTTTGGTGTCGATGGGAGTCC -3'
(R):5'- GCAGAAATTTCTAGCTTAAACAGTG -3'
Posted On2016-07-06