Incidental Mutation 'R5268:Corin'
ID399906
Institutional Source Beutler Lab
Gene Symbol Corin
Ensembl Gene ENSMUSG00000005220
Gene Namecorin
SynonymsLrp4
MMRRC Submission 042860-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R5268 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location72300025-72504473 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 72343019 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 421 (S421A)
Ref Sequence ENSEMBL: ENSMUSP00000135511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005352] [ENSMUST00000167460] [ENSMUST00000175766] [ENSMUST00000176974] [ENSMUST00000177290]
Predicted Effect probably damaging
Transcript: ENSMUST00000005352
AA Change: S554A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005352
Gene: ENSMUSG00000005220
AA Change: S554A

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
FRI 205 318 6.15e-11 SMART
LDLa 336 372 1.31e-8 SMART
LDLa 373 408 1.5e-8 SMART
LDLa 409 447 5.47e-11 SMART
LDLa 448 484 1.22e-8 SMART
low complexity region 508 521 N/A INTRINSIC
FRI 522 643 2.75e-31 SMART
LDLa 647 684 2.19e-10 SMART
LDLa 685 722 1.76e-5 SMART
LDLa 723 759 4.18e-7 SMART
SR 758 853 3.99e-10 SMART
Tryp_SPc 868 1097 5.45e-76 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167460
AA Change: S488A

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127389
Gene: ENSMUSG00000005220
AA Change: S488A

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 342 1.5e-8 SMART
LDLa 343 381 5.47e-11 SMART
LDLa 382 418 1.22e-8 SMART
low complexity region 442 455 N/A INTRINSIC
FRI 456 577 2.75e-31 SMART
LDLa 581 618 2.19e-10 SMART
LDLa 619 656 1.76e-5 SMART
LDLa 657 693 4.18e-7 SMART
SR 692 787 3.99e-10 SMART
Tryp_SPc 802 1031 5.45e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000175766
AA Change: S413A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135889
Gene: ENSMUSG00000005220
AA Change: S413A

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
FRI 137 250 6.15e-11 SMART
LDLa 268 304 1.31e-8 SMART
LDLa 305 343 2.07e-11 SMART
low complexity region 367 380 N/A INTRINSIC
FRI 381 502 2.75e-31 SMART
LDLa 506 543 2.19e-10 SMART
LDLa 544 581 1.76e-5 SMART
LDLa 582 618 4.18e-7 SMART
SR 617 712 3.99e-10 SMART
Tryp_SPc 727 956 5.45e-76 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176396
Predicted Effect possibly damaging
Transcript: ENSMUST00000176974
AA Change: S451A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135722
Gene: ENSMUSG00000005220
AA Change: S451A

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 139 252 6.15e-11 SMART
LDLa 270 306 1.31e-8 SMART
LDLa 307 344 3.86e-11 SMART
LDLa 345 381 1.22e-8 SMART
low complexity region 405 418 N/A INTRINSIC
FRI 419 540 2.75e-31 SMART
LDLa 544 581 2.19e-10 SMART
LDLa 582 619 1.76e-5 SMART
LDLa 620 656 4.18e-7 SMART
SR 655 750 3.99e-10 SMART
Tryp_SPc 765 994 5.45e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177290
AA Change: S421A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135511
Gene: ENSMUSG00000005220
AA Change: S421A

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
FRI 72 185 6.15e-11 SMART
LDLa 203 239 1.31e-8 SMART
LDLa 240 275 1.5e-8 SMART
LDLa 276 314 5.47e-11 SMART
LDLa 315 351 1.22e-8 SMART
low complexity region 375 388 N/A INTRINSIC
FRI 389 510 2.75e-31 SMART
LDLa 514 551 2.19e-10 SMART
LDLa 552 589 1.76e-5 SMART
LDLa 590 626 4.18e-7 SMART
SR 625 720 3.99e-10 SMART
Tryp_SPc 735 964 5.45e-76 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II transmembrane serine protease class of the trypsin superfamily. Members of this family are composed of multiple structurally distinct domains. The encoded protein converts pro-atrial natriuretic peptide to biologically active atrial natriuretic peptide, a cardiac hormone that regulates blood volume and pressure. This protein may also function as a pro-brain-type natriuretic peptide convertase. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display hypertension that is enhanced by high-salt diet and pregnancy, increased body weight, and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810032O08Rik G T 11: 116,671,756 M18I probably benign Het
Adamtsl4 C A 3: 95,680,163 R701L probably damaging Het
Adgrf5 T C 17: 43,450,999 V1195A probably damaging Het
Agpat5 A G 8: 18,881,862 T333A possibly damaging Het
Aspm G T 1: 139,464,295 G795C probably damaging Het
Car4 C A 11: 84,965,800 Q305K probably benign Het
Catsperg1 T C 7: 29,195,247 N612S probably benign Het
Cdc5l G A 17: 45,415,585 R354W probably damaging Het
Cdh9 G A 15: 16,851,013 V623I probably benign Het
Cfap65 A G 1: 74,924,902 V629A probably benign Het
Chd1 G A 17: 15,735,743 V535I probably damaging Het
Col12a1 A G 9: 79,678,047 V1316A probably damaging Het
Col6a3 A T 1: 90,785,243 D1721E unknown Het
Cop1 T A 1: 159,327,164 F647L probably damaging Het
Crb2 T C 2: 37,790,821 V587A probably damaging Het
Ctc1 T A 11: 69,029,810 V646E possibly damaging Het
Cyp2a12 A T 7: 27,031,218 M203L probably benign Het
Dcdc2c T A 12: 28,516,657 K336M possibly damaging Het
Ddx39 G A 8: 83,722,321 R275H probably benign Het
Des A G 1: 75,362,928 N310S possibly damaging Het
Dlk1 C A 12: 109,459,838 S212R probably benign Het
Dnajc5b A G 3: 19,579,060 E149G probably benign Het
Dpep1 A T 8: 123,194,089 I3F probably benign Het
Eml6 T A 11: 29,803,108 R934S probably benign Het
Ercc6l2 T C 13: 63,869,111 L676P possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Frem2 T A 3: 53,653,154 I1311F probably damaging Het
Gldc T A 19: 30,145,725 M257L probably damaging Het
Gm5538 A G 3: 59,752,023 E299G probably damaging Het
Gm8674 T G 13: 49,901,354 noncoding transcript Het
Gnai3 C T 3: 108,123,541 probably null Het
Gtf3a A G 5: 146,955,155 D300G probably damaging Het
Haus3 A T 5: 34,166,105 V387D probably damaging Het
Hpf1 T A 8: 60,893,734 F28I possibly damaging Het
Iars A G 13: 49,690,491 D147G probably damaging Het
Ibtk A T 9: 85,743,690 D2E probably benign Het
Ift140 T A 17: 25,020,627 I86K possibly damaging Het
Igf2bp2 T A 16: 22,079,491 I235F probably damaging Het
Ighv3-8 G T 12: 114,322,632 A30E probably benign Het
Kcnq5 T A 1: 21,505,725 T252S probably damaging Het
Lrrc4b A T 7: 44,461,363 N220Y probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mamdc4 T C 2: 25,564,690 T1037A possibly damaging Het
Mbd5 A T 2: 49,272,094 I863F possibly damaging Het
Muc4 T A 16: 32,751,666 S515T possibly damaging Het
Mylk4 T A 13: 32,708,881 probably null Het
Neu4 G A 1: 94,024,947 R346H probably benign Het
Nxpe5 T A 5: 138,239,938 Y253* probably null Het
Olfml2b A T 1: 170,649,761 E155V probably damaging Het
Olfr160 T A 9: 37,712,004 I92F probably damaging Het
Olfr2 T A 7: 107,000,904 N319Y probably benign Het
Olfr304 A G 7: 86,385,659 *334Q probably null Het
Pamr1 G A 2: 102,586,684 A114T probably damaging Het
Pdzd2 T A 15: 12,592,177 N127I probably damaging Het
Pglyrp4 C T 3: 90,726,964 L5F probably damaging Het
Plce1 T A 19: 38,758,835 S1667T possibly damaging Het
Qser1 A T 2: 104,787,431 V1012E possibly damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rcn3 A T 7: 45,086,779 D168E probably damaging Het
Rdh1 T G 10: 127,759,963 V9G possibly damaging Het
Rin2 A G 2: 145,844,760 T70A probably benign Het
Rnf207 T C 4: 152,313,889 D276G probably damaging Het
Rtel1 C T 2: 181,340,561 S368L probably benign Het
Slc15a5 C A 6: 138,079,753 C55F probably damaging Het
Slc36a4 T C 9: 15,726,916 F213L possibly damaging Het
Spata25 C T 2: 164,828,034 G19D probably damaging Het
St5 A G 7: 109,557,312 L77P probably benign Het
Tas2r102 A T 6: 132,762,397 L89F probably damaging Het
Tbc1d1 A G 5: 64,324,567 K704E probably damaging Het
Tert T G 13: 73,627,354 S75A probably damaging Het
Tiparp T A 3: 65,547,565 L195Q possibly damaging Het
Tmem205 A C 9: 21,926,084 Y57* probably null Het
Tomm22 A G 15: 79,671,227 R5G probably benign Het
Trav10 A T 14: 53,506,058 S39C probably benign Het
Trav6-2 T A 14: 52,667,748 N75K probably benign Het
Trio T C 15: 27,748,286 S2427G probably benign Het
Ttc41 C A 10: 86,744,478 H763N possibly damaging Het
Usp29 A T 7: 6,961,584 N142I probably damaging Het
Vmn1r204 G T 13: 22,556,742 W181L probably damaging Het
Vmn2r76 G A 7: 86,226,059 T570M probably damaging Het
Wdr90 A G 17: 25,850,845 L1173P probably damaging Het
Wnt9a T A 11: 59,328,570 C141S probably damaging Het
Zfp462 A T 4: 55,012,299 I1422L probably benign Het
Other mutations in Corin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Corin APN 5 72304888 missense probably damaging 1.00
IGL01114:Corin APN 5 72305011 missense probably damaging 1.00
IGL01351:Corin APN 5 72338991 missense probably damaging 1.00
IGL01516:Corin APN 5 72454487 nonsense probably null
IGL01785:Corin APN 5 72339876 missense probably damaging 1.00
IGL01786:Corin APN 5 72339876 missense probably damaging 1.00
IGL01845:Corin APN 5 72353939 missense probably damaging 1.00
IGL02097:Corin APN 5 72372146 missense probably damaging 1.00
IGL02629:Corin APN 5 72332673 missense probably damaging 1.00
IGL03085:Corin APN 5 72353930 missense probably damaging 1.00
IGL03120:Corin APN 5 72360689 missense probably damaging 1.00
IGL03150:Corin APN 5 72302858 missense probably damaging 1.00
IGL03183:Corin APN 5 72301586 missense probably damaging 0.99
IGL03185:Corin APN 5 72332781 missense probably damaging 1.00
IGL03408:Corin APN 5 72342961 missense probably benign 0.40
alpaca UTSW 5 72503952 missense possibly damaging 0.85
R0078:Corin UTSW 5 72454473 missense possibly damaging 0.77
R0724:Corin UTSW 5 72332795 splice site probably benign
R1065:Corin UTSW 5 72301650 nonsense probably null
R1301:Corin UTSW 5 72304933 missense possibly damaging 0.81
R1466:Corin UTSW 5 72302790 critical splice donor site probably null
R1466:Corin UTSW 5 72302790 critical splice donor site probably null
R1520:Corin UTSW 5 72330895 missense probably damaging 1.00
R1584:Corin UTSW 5 72302790 critical splice donor site probably null
R1617:Corin UTSW 5 72503952 missense possibly damaging 0.85
R1912:Corin UTSW 5 72358403 missense probably damaging 1.00
R2059:Corin UTSW 5 72316051 missense possibly damaging 0.76
R2173:Corin UTSW 5 72504079 missense probably benign 0.01
R2242:Corin UTSW 5 72332711 missense probably damaging 1.00
R2373:Corin UTSW 5 72339038 missense probably damaging 1.00
R2850:Corin UTSW 5 72304955 missense probably damaging 1.00
R3683:Corin UTSW 5 72330855 missense probably damaging 1.00
R3684:Corin UTSW 5 72330855 missense probably damaging 1.00
R3790:Corin UTSW 5 72435298 missense probably benign 0.38
R3847:Corin UTSW 5 72422165 missense probably benign 0.13
R3926:Corin UTSW 5 72372130 missense probably damaging 1.00
R3939:Corin UTSW 5 72339879 missense possibly damaging 0.80
R3945:Corin UTSW 5 72358424 missense probably damaging 1.00
R4079:Corin UTSW 5 72503883 missense probably benign 0.03
R4224:Corin UTSW 5 72343108 missense probably damaging 1.00
R4473:Corin UTSW 5 72339057 missense probably damaging 1.00
R4585:Corin UTSW 5 72329699 missense probably damaging 1.00
R4586:Corin UTSW 5 72329699 missense probably damaging 1.00
R4849:Corin UTSW 5 72302835 missense probably damaging 1.00
R4926:Corin UTSW 5 72372182 missense probably damaging 1.00
R5080:Corin UTSW 5 72353851 intron probably benign
R5138:Corin UTSW 5 72339059 missense probably damaging 1.00
R5262:Corin UTSW 5 72304955 missense probably damaging 1.00
R5302:Corin UTSW 5 72316098 missense probably benign 0.07
R5307:Corin UTSW 5 72356978 missense probably damaging 1.00
R5324:Corin UTSW 5 72435257 missense probably damaging 1.00
R5352:Corin UTSW 5 72305033 missense probably benign 0.04
R5373:Corin UTSW 5 72304953 missense probably damaging 1.00
R5374:Corin UTSW 5 72304953 missense probably damaging 1.00
R5484:Corin UTSW 5 72358484 missense probably benign 0.15
R5502:Corin UTSW 5 72316106 nonsense probably null
R5544:Corin UTSW 5 72305014 nonsense probably null
R5682:Corin UTSW 5 72422154 missense possibly damaging 0.85
R5818:Corin UTSW 5 72435395 missense probably benign 0.00
R5992:Corin UTSW 5 72316389 missense probably benign 0.01
R6115:Corin UTSW 5 72360729 missense probably damaging 1.00
R6181:Corin UTSW 5 72372096 critical splice donor site probably null
R6317:Corin UTSW 5 72339045 missense probably damaging 1.00
R7053:Corin UTSW 5 72301527 missense probably benign 0.28
R7242:Corin UTSW 5 72305055 missense probably benign 0.14
R7452:Corin UTSW 5 72435247 missense possibly damaging 0.94
R7783:Corin UTSW 5 72301624 missense probably benign 0.26
R7903:Corin UTSW 5 72301500 missense probably benign 0.00
R8007:Corin UTSW 5 72316103 missense probably damaging 0.96
R8125:Corin UTSW 5 72358463 missense probably damaging 0.96
R8215:Corin UTSW 5 72305018 missense probably damaging 1.00
R8251:Corin UTSW 5 72356926 missense probably damaging 1.00
Z1177:Corin UTSW 5 72454493 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACTCCTTAGCAGTCTTTATCTGTG -3'
(R):5'- GGAAGCTTAAAGAGGCTGTTTC -3'

Sequencing Primer
(F):5'- GTGTAAATTCAGCTCCGTGC -3'
(R):5'- TGAGCCCATCACTTTGGA -3'
Posted On2016-07-06