Incidental Mutation 'R5193:Slc22a30'
ID399909
Institutional Source Beutler Lab
Gene Symbol Slc22a30
Ensembl Gene ENSMUSG00000052562
Gene Namesolute carrier family 22, member 30
Synonyms
MMRRC Submission 042769-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5193 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8335371-8405111 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 8344393 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 436 (Q436*)
Ref Sequence ENSEMBL: ENSMUSP00000114071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064507] [ENSMUST00000096269] [ENSMUST00000120540]
Predicted Effect probably benign
Transcript: ENSMUST00000064507
SMART Domains Protein: ENSMUSP00000069461
Gene: ENSMUSG00000052562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 439 3.1e-21 PFAM
Pfam:MFS_1 127 433 8.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096269
SMART Domains Protein: ENSMUSP00000093988
Gene: ENSMUSG00000052562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 527 9.6e-27 PFAM
Pfam:MFS_1 140 376 1.2e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120540
AA Change: Q436*
SMART Domains Protein: ENSMUSP00000114071
Gene: ENSMUSG00000052562
AA Change: Q436*

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 435 1.3e-20 PFAM
Pfam:MFS_1 127 435 1.5e-19 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 A T 2: 150,835,306 *56R probably null Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arfgap3 C T 15: 83,332,697 A156T probably benign Het
Bpifc T C 10: 86,000,633 T3A probably benign Het
Ccdc7a T A 8: 128,988,797 I269L probably benign Het
Cd151 A G 7: 141,470,693 Y253C probably damaging Het
Cenpl C A 1: 161,083,467 S328* probably null Het
Cfl1 T A 19: 5,492,552 V20D probably damaging Het
Clec14a A G 12: 58,268,614 L74P probably damaging Het
Cnn1 A T 9: 22,107,836 D196V probably damaging Het
Cst13 C A 2: 148,828,223 C104* probably null Het
Det1 A G 7: 78,843,554 V234A probably damaging Het
Efnb2 A G 8: 8,623,162 M165T probably damaging Het
Fbxo10 T A 4: 45,051,573 K339* probably null Het
Fnta A T 8: 26,011,218 probably null Het
Fsip2 A T 2: 82,982,994 Y3219F possibly damaging Het
Gm340 A G 19: 41,582,530 D54G probably damaging Het
Gprin2 C T 14: 34,194,875 V313M possibly damaging Het
Hars A G 18: 36,767,305 L448S possibly damaging Het
Hipk3 A G 2: 104,430,000 I1166T possibly damaging Het
Il31ra T C 13: 112,524,330 E602G probably benign Het
Kctd15 A G 7: 34,644,857 L123P probably damaging Het
Kif1bp T C 10: 62,559,396 D489G possibly damaging Het
Krt1 C A 15: 101,845,922 S631I unknown Het
Lancl1 T A 1: 67,021,014 Y84F probably benign Het
Mafa G T 15: 75,747,817 P36T unknown Het
Magi2 G A 5: 20,358,972 probably null Het
Mcm9 T A 10: 53,616,038 I396F probably damaging Het
Mrgprh T C 17: 12,877,055 F61L probably damaging Het
Olfr1 TAGCGGTCGTA T 11: 73,395,653 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1141 A T 2: 87,753,104 D296E possibly damaging Het
Olfr1511 A G 14: 52,390,612 W54R probably benign Het
Olfr576 T A 7: 102,965,936 F279I possibly damaging Het
Pcsk5 T A 19: 17,564,810 T806S possibly damaging Het
Pigc T C 1: 161,970,896 I149T possibly damaging Het
Pou5f2 C A 13: 78,024,964 N8K probably benign Het
Pou6f2 T C 13: 18,125,544 probably benign Het
Prl3d2 T A 13: 27,122,329 M13K possibly damaging Het
Pzp T C 6: 128,502,334 N619D probably benign Het
Rnps1 G A 17: 24,418,543 S53N probably benign Het
Scaf8 C G 17: 3,190,165 A604G probably benign Het
Scn10a T C 9: 119,609,655 N1716S probably damaging Het
Slc17a2 A G 13: 23,819,862 probably null Het
Syne2 A G 12: 76,094,420 D6102G probably damaging Het
Tbc1d16 A T 11: 119,158,820 D283E probably benign Het
Tet1 T C 10: 62,838,247 D1350G probably benign Het
Trpa1 A G 1: 14,875,917 Y997H possibly damaging Het
Tyro3 T C 2: 119,810,517 L494P probably damaging Het
Uba6 G T 5: 86,124,422 Q803K probably benign Het
Vgll2 T A 10: 52,027,992 L317Q possibly damaging Het
Wdr62 A T 7: 30,265,167 I384N probably damaging Het
Wdtc1 G A 4: 133,294,367 R619* probably null Het
Xkr6 A G 14: 63,818,907 D89G possibly damaging Het
Other mutations in Slc22a30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Slc22a30 APN 19 8335788 missense probably benign 0.29
IGL01894:Slc22a30 APN 19 8386657 missense probably benign 0.28
IGL02795:Slc22a30 APN 19 8400895 missense probably damaging 1.00
IGL02798:Slc22a30 APN 19 8370085 missense probably damaging 0.96
IGL03267:Slc22a30 APN 19 8337958 missense probably benign 0.00
R0089:Slc22a30 UTSW 19 8370197 missense probably benign 0.03
R0243:Slc22a30 UTSW 19 8345357 missense probably benign 0.01
R1033:Slc22a30 UTSW 19 8335801 nonsense probably null
R1781:Slc22a30 UTSW 19 8335772 missense probably damaging 1.00
R2098:Slc22a30 UTSW 19 8400811 missense probably damaging 1.00
R3874:Slc22a30 UTSW 19 8336849 missense probably benign 0.31
R4091:Slc22a30 UTSW 19 8404545 missense probably damaging 1.00
R4799:Slc22a30 UTSW 19 8344404 missense probably benign
R5108:Slc22a30 UTSW 19 8386426 missense probably damaging 1.00
R5191:Slc22a30 UTSW 19 8344393 nonsense probably null
R5192:Slc22a30 UTSW 19 8344393 nonsense probably null
R5195:Slc22a30 UTSW 19 8344393 nonsense probably null
R5253:Slc22a30 UTSW 19 8344393 nonsense probably null
R5254:Slc22a30 UTSW 19 8344393 nonsense probably null
R5255:Slc22a30 UTSW 19 8344393 nonsense probably null
R5256:Slc22a30 UTSW 19 8344393 nonsense probably null
R5377:Slc22a30 UTSW 19 8344393 nonsense probably null
R5378:Slc22a30 UTSW 19 8344393 nonsense probably null
R5400:Slc22a30 UTSW 19 8344393 nonsense probably null
R5401:Slc22a30 UTSW 19 8344393 nonsense probably null
R5481:Slc22a30 UTSW 19 8336837 missense probably benign 0.01
R5644:Slc22a30 UTSW 19 8404616 missense possibly damaging 0.72
R5679:Slc22a30 UTSW 19 8335771 missense possibly damaging 0.90
R5699:Slc22a30 UTSW 19 8344393 nonsense probably null
R5704:Slc22a30 UTSW 19 8344393 nonsense probably null
R5706:Slc22a30 UTSW 19 8344393 nonsense probably null
R5767:Slc22a30 UTSW 19 8344393 nonsense probably null
R5770:Slc22a30 UTSW 19 8386527 missense probably damaging 0.99
R5784:Slc22a30 UTSW 19 8344393 nonsense probably null
R5793:Slc22a30 UTSW 19 8336819 missense possibly damaging 0.95
R5813:Slc22a30 UTSW 19 8404581 missense probably benign 0.07
R6101:Slc22a30 UTSW 19 8337868 splice site probably null
R6105:Slc22a30 UTSW 19 8337868 splice site probably null
R6327:Slc22a30 UTSW 19 8335722 utr 3 prime probably benign
R6958:Slc22a30 UTSW 19 8386701 missense probably damaging 0.98
R7162:Slc22a30 UTSW 19 8336717 splice site probably null
R7375:Slc22a30 UTSW 19 8404691 missense probably damaging 1.00
R7572:Slc22a30 UTSW 19 8335708 missense unknown
R7755:Slc22a30 UTSW 19 8336769 missense probably damaging 1.00
R8114:Slc22a30 UTSW 19 8404540 nonsense probably null
R8248:Slc22a30 UTSW 19 8370199 missense probably benign 0.12
R8677:Slc22a30 UTSW 19 8386671 missense probably benign 0.21
R8854:Slc22a30 UTSW 19 8386390 critical splice donor site probably null
R8900:Slc22a30 UTSW 19 8337976 missense probably damaging 1.00
Z1088:Slc22a30 UTSW 19 8335775 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTTGATTAACAACCCAACTGGC -3'
(R):5'- CTGGTTCTCATGTCCCTGAG -3'

Sequencing Primer
(F):5'- GGCATACATAGTACATACAGTTAGTC -3'
(R):5'- CCTCAAGGTAAGGAAAGAGT -3'
Posted On2016-07-06