Incidental Mutation 'R5268:Gtf3a'
ID399910
Institutional Source Beutler Lab
Gene Symbol Gtf3a
Ensembl Gene ENSMUSG00000016503
Gene Namegeneral transcription factor III A
Synonyms
MMRRC Submission 042860-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R5268 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location146948657-146955614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146955155 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 300 (D300G)
Ref Sequence ENSEMBL: ENSMUSP00000119607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016654] [ENSMUST00000066675] [ENSMUST00000110564] [ENSMUST00000110566] [ENSMUST00000125217] [ENSMUST00000132102] [ENSMUST00000140526] [ENSMUST00000146511]
Predicted Effect probably benign
Transcript: ENSMUST00000016654
SMART Domains Protein: ENSMUSP00000016654
Gene: ENSMUSG00000016510

DomainStartEndE-ValueType
Pfam:IF3_N 70 144 5e-16 PFAM
Pfam:IF3_C 152 240 1.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066675
SMART Domains Protein: ENSMUSP00000063398
Gene: ENSMUSG00000016510

DomainStartEndE-ValueType
Pfam:IF3_N 73 144 2.1e-13 PFAM
Pfam:IF3_C 153 238 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110564
SMART Domains Protein: ENSMUSP00000106193
Gene: ENSMUSG00000016510

DomainStartEndE-ValueType
Pfam:IF3_N 70 144 5e-16 PFAM
Pfam:IF3_C 152 240 1.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110566
SMART Domains Protein: ENSMUSP00000106195
Gene: ENSMUSG00000016510

DomainStartEndE-ValueType
Pfam:IF3_N 70 144 5e-16 PFAM
Pfam:IF3_C 152 240 1.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125217
SMART Domains Protein: ENSMUSP00000120283
Gene: ENSMUSG00000016510

DomainStartEndE-ValueType
Pfam:IF3_N 70 113 1.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132102
AA Change: D300G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115824
Gene: ENSMUSG00000016503
AA Change: D300G

DomainStartEndE-ValueType
ZnF_C2H2 38 62 1.86e0 SMART
ZnF_C2H2 68 92 6.32e-3 SMART
ZnF_C2H2 98 123 1.38e-3 SMART
ZnF_C2H2 130 154 1.33e-1 SMART
ZnF_C2H2 160 184 1.45e-2 SMART
ZnF_C2H2 187 211 8.09e-1 SMART
ZnF_C2H2 215 237 5.99e-4 SMART
ZnF_C2H2 244 269 3.63e-3 SMART
ZnF_C2H2 275 299 2.09e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133682
Predicted Effect probably benign
Transcript: ENSMUST00000140526
SMART Domains Protein: ENSMUSP00000120064
Gene: ENSMUSG00000016510

DomainStartEndE-ValueType
Pfam:IF3_N 70 109 6.9e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146511
AA Change: D300G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119607
Gene: ENSMUSG00000016503
AA Change: D300G

DomainStartEndE-ValueType
ZnF_C2H2 38 62 1.86e0 SMART
ZnF_C2H2 68 92 6.32e-3 SMART
ZnF_C2H2 98 123 1.38e-3 SMART
ZnF_C2H2 130 154 1.33e-1 SMART
ZnF_C2H2 160 184 1.45e-2 SMART
ZnF_C2H2 187 211 8.09e-1 SMART
ZnF_C2H2 215 237 5.99e-4 SMART
ZnF_C2H2 244 269 3.63e-3 SMART
ZnF_C2H2 275 299 2.09e-3 SMART
low complexity region 338 361 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: The product of this gene is a zinc finger protein with nine Cis[2]-His[2] zinc finger domains. It functions as an RNA polymerase III transcription factor to induce transcription of the 5S rRNA genes. The protein binds to a 50 bp internal promoter in the 5S genes called the internal control region (ICR), and nucleates formation of a stable preinitiation complex. This complex recruits the TFIIIC and TFIIIB transcription factors and RNA polymerase III to form the complete transcription complex. The protein is thought to be translated using a non-AUG translation initiation site in mammals based on sequence analysis, protein homology, and the size of the purified protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810032O08Rik G T 11: 116,671,756 M18I probably benign Het
Adamtsl4 C A 3: 95,680,163 R701L probably damaging Het
Adgrf5 T C 17: 43,450,999 V1195A probably damaging Het
Agpat5 A G 8: 18,881,862 T333A possibly damaging Het
Aspm G T 1: 139,464,295 G795C probably damaging Het
Car4 C A 11: 84,965,800 Q305K probably benign Het
Catsperg1 T C 7: 29,195,247 N612S probably benign Het
Cdc5l G A 17: 45,415,585 R354W probably damaging Het
Cdh9 G A 15: 16,851,013 V623I probably benign Het
Cfap65 A G 1: 74,924,902 V629A probably benign Het
Chd1 G A 17: 15,735,743 V535I probably damaging Het
Col12a1 A G 9: 79,678,047 V1316A probably damaging Het
Col6a3 A T 1: 90,785,243 D1721E unknown Het
Cop1 T A 1: 159,327,164 F647L probably damaging Het
Corin A C 5: 72,343,019 S421A probably damaging Het
Crb2 T C 2: 37,790,821 V587A probably damaging Het
Ctc1 T A 11: 69,029,810 V646E possibly damaging Het
Cyp2a12 A T 7: 27,031,218 M203L probably benign Het
Dcdc2c T A 12: 28,516,657 K336M possibly damaging Het
Ddx39 G A 8: 83,722,321 R275H probably benign Het
Des A G 1: 75,362,928 N310S possibly damaging Het
Dlk1 C A 12: 109,459,838 S212R probably benign Het
Dnajc5b A G 3: 19,579,060 E149G probably benign Het
Dpep1 A T 8: 123,194,089 I3F probably benign Het
Eml6 T A 11: 29,803,108 R934S probably benign Het
Ercc6l2 T C 13: 63,869,111 L676P possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Frem2 T A 3: 53,653,154 I1311F probably damaging Het
Gldc T A 19: 30,145,725 M257L probably damaging Het
Gm5538 A G 3: 59,752,023 E299G probably damaging Het
Gm8674 T G 13: 49,901,354 noncoding transcript Het
Gnai3 C T 3: 108,123,541 probably null Het
Haus3 A T 5: 34,166,105 V387D probably damaging Het
Hpf1 T A 8: 60,893,734 F28I possibly damaging Het
Iars A G 13: 49,690,491 D147G probably damaging Het
Ibtk A T 9: 85,743,690 D2E probably benign Het
Ift140 T A 17: 25,020,627 I86K possibly damaging Het
Igf2bp2 T A 16: 22,079,491 I235F probably damaging Het
Ighv3-8 G T 12: 114,322,632 A30E probably benign Het
Kcnq5 T A 1: 21,505,725 T252S probably damaging Het
Lrrc4b A T 7: 44,461,363 N220Y probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mamdc4 T C 2: 25,564,690 T1037A possibly damaging Het
Mbd5 A T 2: 49,272,094 I863F possibly damaging Het
Muc4 T A 16: 32,751,666 S515T possibly damaging Het
Mylk4 T A 13: 32,708,881 probably null Het
Neu4 G A 1: 94,024,947 R346H probably benign Het
Nxpe5 T A 5: 138,239,938 Y253* probably null Het
Olfml2b A T 1: 170,649,761 E155V probably damaging Het
Olfr160 T A 9: 37,712,004 I92F probably damaging Het
Olfr2 T A 7: 107,000,904 N319Y probably benign Het
Olfr304 A G 7: 86,385,659 *334Q probably null Het
Pamr1 G A 2: 102,586,684 A114T probably damaging Het
Pdzd2 T A 15: 12,592,177 N127I probably damaging Het
Pglyrp4 C T 3: 90,726,964 L5F probably damaging Het
Plce1 T A 19: 38,758,835 S1667T possibly damaging Het
Qser1 A T 2: 104,787,431 V1012E possibly damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rcn3 A T 7: 45,086,779 D168E probably damaging Het
Rdh1 T G 10: 127,759,963 V9G possibly damaging Het
Rin2 A G 2: 145,844,760 T70A probably benign Het
Rnf207 T C 4: 152,313,889 D276G probably damaging Het
Rtel1 C T 2: 181,340,561 S368L probably benign Het
Slc15a5 C A 6: 138,079,753 C55F probably damaging Het
Slc36a4 T C 9: 15,726,916 F213L possibly damaging Het
Spata25 C T 2: 164,828,034 G19D probably damaging Het
St5 A G 7: 109,557,312 L77P probably benign Het
Tas2r102 A T 6: 132,762,397 L89F probably damaging Het
Tbc1d1 A G 5: 64,324,567 K704E probably damaging Het
Tert T G 13: 73,627,354 S75A probably damaging Het
Tiparp T A 3: 65,547,565 L195Q possibly damaging Het
Tmem205 A C 9: 21,926,084 Y57* probably null Het
Tomm22 A G 15: 79,671,227 R5G probably benign Het
Trav10 A T 14: 53,506,058 S39C probably benign Het
Trav6-2 T A 14: 52,667,748 N75K probably benign Het
Trio T C 15: 27,748,286 S2427G probably benign Het
Ttc41 C A 10: 86,744,478 H763N possibly damaging Het
Usp29 A T 7: 6,961,584 N142I probably damaging Het
Vmn1r204 G T 13: 22,556,742 W181L probably damaging Het
Vmn2r76 G A 7: 86,226,059 T570M probably damaging Het
Wdr90 A G 17: 25,850,845 L1173P probably damaging Het
Wnt9a T A 11: 59,328,570 C141S probably damaging Het
Zfp462 A T 4: 55,012,299 I1422L probably benign Het
Other mutations in Gtf3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03096:Gtf3a APN 5 146953953 missense probably damaging 1.00
IGL03404:Gtf3a APN 5 146950639 splice site probably null
R0227:Gtf3a UTSW 5 146955389 missense probably damaging 1.00
R0365:Gtf3a UTSW 5 146948937 missense probably damaging 1.00
R0480:Gtf3a UTSW 5 146953229 missense probably damaging 1.00
R1697:Gtf3a UTSW 5 146951913 missense possibly damaging 0.88
R2171:Gtf3a UTSW 5 146955462 missense probably benign 0.00
R3917:Gtf3a UTSW 5 146955434 missense probably benign 0.26
R4867:Gtf3a UTSW 5 146951913 nonsense probably null
R5081:Gtf3a UTSW 5 146951282 missense probably benign 0.36
R6056:Gtf3a UTSW 5 146955528 unclassified probably benign
R6376:Gtf3a UTSW 5 146953988 unclassified probably null
R7151:Gtf3a UTSW 5 146951275 missense probably benign 0.01
Z1176:Gtf3a UTSW 5 146951204 missense not run
Predicted Primers PCR Primer
(F):5'- TATTGCACACTGGACCACTGC -3'
(R):5'- AGACAGACAACTGAGTTGCCC -3'

Sequencing Primer
(F):5'- TGGACCACTGCATCTTAAGG -3'
(R):5'- TGAGTTGCCCATTACACAACGG -3'
Posted On2016-07-06