Incidental Mutation 'R5268:Ltbr'
ID399912
Institutional Source Beutler Lab
Gene Symbol Ltbr
Ensembl Gene ENSMUSG00000030339
Gene Namelymphotoxin B receptor
SynonymsTNF-R-III, TNFRrp, TNFCR, TNFR2-RP, LTbetaR, TNF receptor-related protein, LT-beta receptor, LT beta-R, Tnfbr, Tnfrsf3, Ltar
MMRRC Submission 042860-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R5268 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location125306571-125313885 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 125312794 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 146 (R146W)
Ref Sequence ENSEMBL: ENSMUSP00000032489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032489]
Predicted Effect probably damaging
Transcript: ENSMUST00000032489
AA Change: R146W

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032489
Gene: ENSMUSG00000030339
AA Change: R146W

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
TNFR 43 80 5.73e-5 SMART
TNFR 83 124 3.96e-8 SMART
Blast:TNFR 126 169 3e-7 BLAST
TNFR 172 212 1.95e-7 SMART
transmembrane domain 222 244 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
low complexity region 362 388 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161891
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The major ligands of this receptor include lymphotoxin alpha/beta and tumor necrosis factor ligand superfamily member 14. The encoded protein plays a role in signalling during the development of lymphoid and other organs, lipid metabolism, immune response, and programmed cell death. Activity of this receptor has also been linked to carcinogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygotes for a targeted null mutation lack Peyer's patches, colon-associated lymphoid tissues, and lymph nodes. Mutants also exhibit severely reduced numbers of NK cells and increased susceptibility to Theiler's murine encephalomyelitis virus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810032O08Rik G T 11: 116,671,756 M18I probably benign Het
Adamtsl4 C A 3: 95,680,163 R701L probably damaging Het
Adgrf5 T C 17: 43,450,999 V1195A probably damaging Het
Agpat5 A G 8: 18,881,862 T333A possibly damaging Het
Aspm G T 1: 139,464,295 G795C probably damaging Het
Car4 C A 11: 84,965,800 Q305K probably benign Het
Catsperg1 T C 7: 29,195,247 N612S probably benign Het
Cdc5l G A 17: 45,415,585 R354W probably damaging Het
Cdh9 G A 15: 16,851,013 V623I probably benign Het
Cfap65 A G 1: 74,924,902 V629A probably benign Het
Chd1 G A 17: 15,735,743 V535I probably damaging Het
Col12a1 A G 9: 79,678,047 V1316A probably damaging Het
Col6a3 A T 1: 90,785,243 D1721E unknown Het
Cop1 T A 1: 159,327,164 F647L probably damaging Het
Corin A C 5: 72,343,019 S421A probably damaging Het
Crb2 T C 2: 37,790,821 V587A probably damaging Het
Ctc1 T A 11: 69,029,810 V646E possibly damaging Het
Cyp2a12 A T 7: 27,031,218 M203L probably benign Het
Dcdc2c T A 12: 28,516,657 K336M possibly damaging Het
Ddx39 G A 8: 83,722,321 R275H probably benign Het
Des A G 1: 75,362,928 N310S possibly damaging Het
Dlk1 C A 12: 109,459,838 S212R probably benign Het
Dnajc5b A G 3: 19,579,060 E149G probably benign Het
Dpep1 A T 8: 123,194,089 I3F probably benign Het
Eml6 T A 11: 29,803,108 R934S probably benign Het
Ercc6l2 T C 13: 63,869,111 L676P possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Frem2 T A 3: 53,653,154 I1311F probably damaging Het
Gldc T A 19: 30,145,725 M257L probably damaging Het
Gm5538 A G 3: 59,752,023 E299G probably damaging Het
Gm8674 T G 13: 49,901,354 noncoding transcript Het
Gnai3 C T 3: 108,123,541 probably null Het
Gtf3a A G 5: 146,955,155 D300G probably damaging Het
Haus3 A T 5: 34,166,105 V387D probably damaging Het
Hpf1 T A 8: 60,893,734 F28I possibly damaging Het
Iars A G 13: 49,690,491 D147G probably damaging Het
Ibtk A T 9: 85,743,690 D2E probably benign Het
Ift140 T A 17: 25,020,627 I86K possibly damaging Het
Igf2bp2 T A 16: 22,079,491 I235F probably damaging Het
Ighv3-8 G T 12: 114,322,632 A30E probably benign Het
Kcnq5 T A 1: 21,505,725 T252S probably damaging Het
Lrrc4b A T 7: 44,461,363 N220Y probably damaging Het
Mamdc4 T C 2: 25,564,690 T1037A possibly damaging Het
Mbd5 A T 2: 49,272,094 I863F possibly damaging Het
Muc4 T A 16: 32,751,666 S515T possibly damaging Het
Mylk4 T A 13: 32,708,881 probably null Het
Neu4 G A 1: 94,024,947 R346H probably benign Het
Nxpe5 T A 5: 138,239,938 Y253* probably null Het
Olfml2b A T 1: 170,649,761 E155V probably damaging Het
Olfr160 T A 9: 37,712,004 I92F probably damaging Het
Olfr2 T A 7: 107,000,904 N319Y probably benign Het
Olfr304 A G 7: 86,385,659 *334Q probably null Het
Pamr1 G A 2: 102,586,684 A114T probably damaging Het
Pdzd2 T A 15: 12,592,177 N127I probably damaging Het
Pglyrp4 C T 3: 90,726,964 L5F probably damaging Het
Plce1 T A 19: 38,758,835 S1667T possibly damaging Het
Qser1 A T 2: 104,787,431 V1012E possibly damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rcn3 A T 7: 45,086,779 D168E probably damaging Het
Rdh1 T G 10: 127,759,963 V9G possibly damaging Het
Rin2 A G 2: 145,844,760 T70A probably benign Het
Rnf207 T C 4: 152,313,889 D276G probably damaging Het
Rtel1 C T 2: 181,340,561 S368L probably benign Het
Slc15a5 C A 6: 138,079,753 C55F probably damaging Het
Slc36a4 T C 9: 15,726,916 F213L possibly damaging Het
Spata25 C T 2: 164,828,034 G19D probably damaging Het
St5 A G 7: 109,557,312 L77P probably benign Het
Tas2r102 A T 6: 132,762,397 L89F probably damaging Het
Tbc1d1 A G 5: 64,324,567 K704E probably damaging Het
Tert T G 13: 73,627,354 S75A probably damaging Het
Tiparp T A 3: 65,547,565 L195Q possibly damaging Het
Tmem205 A C 9: 21,926,084 Y57* probably null Het
Tomm22 A G 15: 79,671,227 R5G probably benign Het
Trav10 A T 14: 53,506,058 S39C probably benign Het
Trav6-2 T A 14: 52,667,748 N75K probably benign Het
Trio T C 15: 27,748,286 S2427G probably benign Het
Ttc41 C A 10: 86,744,478 H763N possibly damaging Het
Usp29 A T 7: 6,961,584 N142I probably damaging Het
Vmn1r204 G T 13: 22,556,742 W181L probably damaging Het
Vmn2r76 G A 7: 86,226,059 T570M probably damaging Het
Wdr90 A G 17: 25,850,845 L1173P probably damaging Het
Wnt9a T A 11: 59,328,570 C141S probably damaging Het
Zfp462 A T 4: 55,012,299 I1422L probably benign Het
Other mutations in Ltbr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03349:Ltbr APN 6 125312366 missense probably damaging 0.96
armitage UTSW 6 125312794 missense probably damaging 0.97
bonsai UTSW 6 125312770 missense probably damaging 1.00
kama UTSW 6 125313388 critical splice donor site probably null
marine_blue UTSW 6 125312808 missense probably damaging 0.98
moksha UTSW 6 125308068 missense probably benign 0.00
Questionable UTSW 6 125313375 splice site probably benign
R0090:Ltbr UTSW 6 125309449 splice site probably benign
R0234:Ltbr UTSW 6 125312873 missense probably benign 0.16
R0234:Ltbr UTSW 6 125312873 missense probably benign 0.16
R0553:Ltbr UTSW 6 125313388 critical splice donor site probably null
R0686:Ltbr UTSW 6 125308061 missense possibly damaging 0.88
R0879:Ltbr UTSW 6 125313375 splice site probably benign
R1086:Ltbr UTSW 6 125312740 splice site probably benign
R2118:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2120:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2122:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2124:Ltbr UTSW 6 125309477 missense probably benign 0.34
R2199:Ltbr UTSW 6 125312061 missense probably benign 0.25
R4931:Ltbr UTSW 6 125307474 splice site probably null
R5051:Ltbr UTSW 6 125312770 missense probably damaging 1.00
R5174:Ltbr UTSW 6 125309537 missense probably benign 0.00
R5269:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5357:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5358:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5360:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5361:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5363:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5434:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5436:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5441:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5442:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5533:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5534:Ltbr UTSW 6 125312794 missense probably damaging 0.97
R5859:Ltbr UTSW 6 125312808 missense probably damaging 0.98
R6217:Ltbr UTSW 6 125307454 missense probably damaging 1.00
R6702:Ltbr UTSW 6 125308068 missense probably benign 0.00
R7101:Ltbr UTSW 6 125312800 missense probably benign 0.00
R7584:Ltbr UTSW 6 125307241 missense probably benign 0.09
R7587:Ltbr UTSW 6 125312352 missense probably benign
R8798:Ltbr UTSW 6 125307295 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCAGTTCATGTCTTGGCAG -3'
(R):5'- TGCATGATGGGTACGACTGG -3'

Sequencing Primer
(F):5'- GACTGATAGATTCTTTATGGTTCTCC -3'
(R):5'- TACGACTGGGAGGGCCAG -3'
Posted On2016-07-06