Incidental Mutation 'R5194:Schip1'
ID399928
Institutional Source Beutler Lab
Gene Symbol Schip1
Ensembl Gene ENSMUSG00000027777
Gene Nameschwannomin interacting protein 1
SynonymsSCHIP-1
MMRRC Submission 042770-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.566) question?
Stock #R5194 (G1)
Quality Score149
Status Validated
Chromosome3
Chromosomal Location68064802-68626481 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68494872 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 122 (V122A)
Ref Sequence ENSEMBL: ENSMUSP00000029346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029346] [ENSMUST00000169909] [ENSMUST00000182006] [ENSMUST00000182532] [ENSMUST00000182719] [ENSMUST00000192555]
Predicted Effect probably benign
Transcript: ENSMUST00000029346
AA Change: V122A

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000029346
Gene: ENSMUSG00000027777
AA Change: V122A

DomainStartEndE-ValueType
low complexity region 33 49 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 95 113 N/A INTRINSIC
low complexity region 123 137 N/A INTRINSIC
low complexity region 186 198 N/A INTRINSIC
Pfam:SCHIP-1 252 481 3.1e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169909
SMART Domains Protein: ENSMUSP00000129152
Gene: ENSMUSG00000027777

DomainStartEndE-ValueType
Pfam:SCHIP-1 20 256 4.3e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182006
AA Change: V197A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000138212
Gene: ENSMUSG00000102422
AA Change: V197A

DomainStartEndE-ValueType
Pfam:IQ-like 1 97 1e-54 PFAM
low complexity region 108 124 N/A INTRINSIC
low complexity region 129 142 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 261 273 N/A INTRINSIC
Pfam:SCHIP-1 323 559 9.8e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182532
AA Change: V94A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000138245
Gene: ENSMUSG00000027777
AA Change: V94A

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 26 39 N/A INTRINSIC
low complexity region 67 85 N/A INTRINSIC
low complexity region 95 109 N/A INTRINSIC
low complexity region 158 170 N/A INTRINSIC
Pfam:SCHIP-1 220 456 6.6e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182719
AA Change: V94A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000138207
Gene: ENSMUSG00000027777
AA Change: V94A

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 26 39 N/A INTRINSIC
low complexity region 67 85 N/A INTRINSIC
low complexity region 95 109 N/A INTRINSIC
low complexity region 158 170 N/A INTRINSIC
Pfam:SCHIP-1 220 456 6.6e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192555
AA Change: V94A

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000142090
Gene: ENSMUSG00000027777
AA Change: V94A

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 26 39 N/A INTRINSIC
low complexity region 67 85 N/A INTRINSIC
low complexity region 95 109 N/A INTRINSIC
low complexity region 158 170 N/A INTRINSIC
Pfam:SCHIP-1 220 388 1.1e-103 PFAM
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal lethality, skeletal and craniofacial defects and defective cell mirgration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,250 N82D probably benign Het
Acadm C T 3: 153,933,118 R206H possibly damaging Het
Acly T A 11: 100,523,546 Y18F probably benign Het
Acnat2 G T 4: 49,380,452 Q291K probably benign Het
Agtpbp1 T C 13: 59,500,639 I456V probably benign Het
Ankrd7 A G 6: 18,868,077 N114S possibly damaging Het
Arfgef1 A T 1: 10,204,907 L307I probably benign Het
Arhgef2 A T 3: 88,635,649 I383F probably damaging Het
Cbs C T 17: 31,624,224 probably null Het
Cep135 T C 5: 76,615,777 V538A probably benign Het
D11Wsu47e T C 11: 113,688,828 S350P possibly damaging Het
Dennd5a T C 7: 109,933,729 E254G probably damaging Het
Drc7 T C 8: 95,061,717 V236A probably benign Het
Dtna C T 18: 23,590,245 Q169* probably null Het
Egfem1 G A 3: 29,357,196 probably null Het
Eif2ak3 T C 6: 70,858,478 S130P possibly damaging Het
Ewsr1 T C 11: 5,082,355 N297S unknown Het
F13a1 T G 13: 36,972,063 D192A probably damaging Het
Fam120a A G 13: 48,880,935 V1067A probably benign Het
Gm13124 A G 4: 144,555,082 V380A probably benign Het
Gm17490 T C 2: 11,626,251 Y5C unknown Het
Gm8587 C T 12: 88,089,786 noncoding transcript Het
H2-Ab1 C T 17: 34,269,378 probably benign Het
Hoxd12 T C 2: 74,675,103 L6P probably damaging Het
Ifi204 C T 1: 173,749,344 D564N possibly damaging Het
Irak2 T C 6: 113,690,790 V444A probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrba A C 3: 86,328,219 N877H probably damaging Het
Mylk3 T C 8: 85,352,866 I388V probably benign Het
Myo9b C T 8: 71,349,089 A1286V probably benign Het
Myt1l A C 12: 29,811,648 D143A unknown Het
Ngfr T C 11: 95,580,982 N63S probably benign Het
Olfr1264 T A 2: 90,021,526 Y180F probably damaging Het
Olfr1347 A G 7: 6,488,520 L118P probably damaging Het
Olfr576 A G 7: 102,965,864 I255V probably benign Het
Olfr698 A T 7: 106,753,219 H56Q probably benign Het
Olfr814 C T 10: 129,874,098 V220I probably benign Het
P2rx7 T C 5: 122,673,795 S390P probably benign Het
Pcdhga4 A C 18: 37,687,741 Q781P probably benign Het
Phip G A 9: 82,908,862 S677F probably benign Het
Ptpdc1 C A 13: 48,586,789 V389F possibly damaging Het
Rab2a T A 4: 8,604,381 I161N probably benign Het
Rnf113a2 T A 12: 84,417,337 M1K probably null Het
Sdr16c5 C A 4: 4,006,663 A210S probably benign Het
Sh3bp1 A G 15: 78,903,101 K83E probably damaging Het
Sipa1l2 T C 8: 125,439,273 S1541G possibly damaging Het
Slc22a21 T C 11: 53,979,847 Y4C probably damaging Het
Smco1 C T 16: 32,273,774 H88Y probably damaging Het
Tll2 T C 19: 41,095,897 D697G probably damaging Het
Trim34a A G 7: 104,260,993 N334S possibly damaging Het
Ubqln1 A G 13: 58,199,033 I64T probably benign Het
Vstm2b T A 7: 40,902,488 probably null Het
Wdr17 A G 8: 54,687,604 F238L probably damaging Het
Wiz T C 17: 32,377,848 probably benign Het
Zfp407 T C 18: 84,561,309 S560G probably benign Het
Other mutations in Schip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Schip1 APN 3 68617777 missense probably damaging 1.00
IGL03354:Schip1 APN 3 68494965 missense possibly damaging 0.94
R0190:Schip1 UTSW 3 68625844 missense probably benign 0.09
R0413:Schip1 UTSW 3 68494613 missense probably damaging 1.00
R1256:Schip1 UTSW 3 68495042 missense probably benign 0.12
R1777:Schip1 UTSW 3 68617684 missense probably damaging 1.00
R2067:Schip1 UTSW 3 68617786 missense probably damaging 1.00
R3027:Schip1 UTSW 3 68494610 missense probably damaging 1.00
R4258:Schip1 UTSW 3 68618630 missense possibly damaging 0.88
R4646:Schip1 UTSW 3 68064964 missense probably benign
R4917:Schip1 UTSW 3 68408485 intron probably benign
R4918:Schip1 UTSW 3 68408485 intron probably benign
R5021:Schip1 UTSW 3 68495252 missense probably benign 0.03
R5225:Schip1 UTSW 3 68494937 missense probably benign
R5719:Schip1 UTSW 3 68408227 intron probably benign
R6460:Schip1 UTSW 3 68494894 missense probably benign 0.37
R7189:Schip1 UTSW 3 68617699 missense probably damaging 1.00
R7189:Schip1 UTSW 3 68617700 missense probably damaging 1.00
R7727:Schip1 UTSW 3 68064984 missense probably benign 0.09
R7757:Schip1 UTSW 3 68617695 missense probably damaging 0.99
R7793:Schip1 UTSW 3 68494578 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGTGCAAATCCTCATCGTCG -3'
(R):5'- AATGCCTCCCAGTCCATTGG -3'

Sequencing Primer
(F):5'- AAATCCTCATCGTCGCCGGG -3'
(R):5'- CCCAGATGCCCGGTTTC -3'
Posted On2016-07-06