Incidental Mutation 'R5194:Acadm'
ID399935
Institutional Source Beutler Lab
Gene Symbol Acadm
Ensembl Gene ENSMUSG00000062908
Gene Nameacyl-Coenzyme A dehydrogenase, medium chain
SynonymsMCAD
MMRRC Submission 042770-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5194 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location153922357-153944632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 153933118 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 206 (R206H)
Ref Sequence ENSEMBL: ENSMUSP00000072483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072697] [ENSMUST00000150070] [ENSMUST00000156310]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072697
AA Change: R206H

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000072483
Gene: ENSMUSG00000062908
AA Change: R206H

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 42 152 2e-27 PFAM
Pfam:Acyl-CoA_dh_M 157 255 2.3e-26 PFAM
Pfam:Acyl-CoA_dh_1 267 416 1.7e-48 PFAM
Pfam:Acyl-CoA_dh_2 283 405 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150070
SMART Domains Protein: ENSMUSP00000121714
Gene: ENSMUSG00000062908

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 36 121 5.4e-21 PFAM
Pfam:Acyl-CoA_dh_M 125 144 5.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156310
SMART Domains Protein: ENSMUSP00000122989
Gene: ENSMUSG00000062908

DomainStartEndE-ValueType
PDB:2A1T|D 1 77 2e-30 PDB
SCOP:d3mdda2 36 88 2e-9 SMART
low complexity region 101 111 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200250
Meta Mutation Damage Score 0.3760 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: This gene encodes a homotetrameric mitochondrial flavoprotein and is a member of the acyl-CoA dehydrogenase family. Members of this family catalyze the first step of fatty acid beta-oxidation, forming a C2-C3 trans-double bond in a FAD-dependent reaction. As beta-oxidation cycles through its four steps, each member of the acyl-CoA dehydrogenase family works at an optimum fatty acid chain-length. This enzyme has its optimum length between C6- and C12-acylCoA. In mice, deficiency of this gene can cause neonatal mortality as well as fasting and cold intolerance. This gene has multiple, intronless pseudogenes. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele display a high degree of postnatal lethality, develop an organic aciduria, fatty liver and an unexpected diffuse cardiomyopathy with multifocal myocyte degeneration and necrosis, and show severe cold intolerance with prior fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,250 N82D probably benign Het
Acly T A 11: 100,523,546 Y18F probably benign Het
Acnat2 G T 4: 49,380,452 Q291K probably benign Het
Agtpbp1 T C 13: 59,500,639 I456V probably benign Het
Ankrd7 A G 6: 18,868,077 N114S possibly damaging Het
Arfgef1 A T 1: 10,204,907 L307I probably benign Het
Arhgef2 A T 3: 88,635,649 I383F probably damaging Het
Cbs C T 17: 31,624,224 probably null Het
Cep135 T C 5: 76,615,777 V538A probably benign Het
D11Wsu47e T C 11: 113,688,828 S350P possibly damaging Het
Dennd5a T C 7: 109,933,729 E254G probably damaging Het
Drc7 T C 8: 95,061,717 V236A probably benign Het
Dtna C T 18: 23,590,245 Q169* probably null Het
Egfem1 G A 3: 29,357,196 probably null Het
Eif2ak3 T C 6: 70,858,478 S130P possibly damaging Het
Ewsr1 T C 11: 5,082,355 N297S unknown Het
F13a1 T G 13: 36,972,063 D192A probably damaging Het
Fam120a A G 13: 48,880,935 V1067A probably benign Het
Gm13124 A G 4: 144,555,082 V380A probably benign Het
Gm17490 T C 2: 11,626,251 Y5C unknown Het
Gm8587 C T 12: 88,089,786 noncoding transcript Het
H2-Ab1 C T 17: 34,269,378 probably benign Het
Hoxd12 T C 2: 74,675,103 L6P probably damaging Het
Ifi204 C T 1: 173,749,344 D564N possibly damaging Het
Irak2 T C 6: 113,690,790 V444A probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrba A C 3: 86,328,219 N877H probably damaging Het
Mylk3 T C 8: 85,352,866 I388V probably benign Het
Myo9b C T 8: 71,349,089 A1286V probably benign Het
Myt1l A C 12: 29,811,648 D143A unknown Het
Ngfr T C 11: 95,580,982 N63S probably benign Het
Olfr1264 T A 2: 90,021,526 Y180F probably damaging Het
Olfr1347 A G 7: 6,488,520 L118P probably damaging Het
Olfr576 A G 7: 102,965,864 I255V probably benign Het
Olfr698 A T 7: 106,753,219 H56Q probably benign Het
Olfr814 C T 10: 129,874,098 V220I probably benign Het
P2rx7 T C 5: 122,673,795 S390P probably benign Het
Pcdhga4 A C 18: 37,687,741 Q781P probably benign Het
Phip G A 9: 82,908,862 S677F probably benign Het
Ptpdc1 C A 13: 48,586,789 V389F possibly damaging Het
Rab2a T A 4: 8,604,381 I161N probably benign Het
Rnf113a2 T A 12: 84,417,337 M1K probably null Het
Schip1 T C 3: 68,494,872 V122A probably benign Het
Sdr16c5 C A 4: 4,006,663 A210S probably benign Het
Sh3bp1 A G 15: 78,903,101 K83E probably damaging Het
Sipa1l2 T C 8: 125,439,273 S1541G possibly damaging Het
Slc22a21 T C 11: 53,979,847 Y4C probably damaging Het
Smco1 C T 16: 32,273,774 H88Y probably damaging Het
Tll2 T C 19: 41,095,897 D697G probably damaging Het
Trim34a A G 7: 104,260,993 N334S possibly damaging Het
Ubqln1 A G 13: 58,199,033 I64T probably benign Het
Vstm2b T A 7: 40,902,488 probably null Het
Wdr17 A G 8: 54,687,604 F238L probably damaging Het
Wiz T C 17: 32,377,848 probably benign Het
Zfp407 T C 18: 84,561,309 S560G probably benign Het
Other mutations in Acadm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02452:Acadm APN 3 153941970 missense probably damaging 1.00
IGL02598:Acadm APN 3 153938544 splice site probably benign
IGL02642:Acadm APN 3 153939083 missense probably damaging 1.00
R0092:Acadm UTSW 3 153941875 splice site probably benign
R0270:Acadm UTSW 3 153936324 missense possibly damaging 0.89
R1543:Acadm UTSW 3 153929572 missense probably damaging 1.00
R1868:Acadm UTSW 3 153930252 missense probably benign 0.03
R1955:Acadm UTSW 3 153929551 missense probably damaging 0.97
R2281:Acadm UTSW 3 153933043 missense possibly damaging 0.75
R3774:Acadm UTSW 3 153933097 missense probably benign
R4768:Acadm UTSW 3 153922942 missense probably benign 0.00
R4994:Acadm UTSW 3 153929584 missense probably damaging 1.00
R5523:Acadm UTSW 3 153938636 missense probably benign 0.13
R5927:Acadm UTSW 3 153939108 missense probably damaging 1.00
R6109:Acadm UTSW 3 153941943 missense probably damaging 1.00
R6223:Acadm UTSW 3 153938549 splice site probably null
R6896:Acadm UTSW 3 153936320 missense probably damaging 0.99
R7108:Acadm UTSW 3 153925800 nonsense probably null
R7182:Acadm UTSW 3 153941881 critical splice donor site probably null
R7334:Acadm UTSW 3 153939061 nonsense probably null
R7440:Acadm UTSW 3 153922989 missense probably damaging 1.00
R7882:Acadm UTSW 3 153938613 nonsense probably null
R8170:Acadm UTSW 3 153944398 missense possibly damaging 0.93
R8405:Acadm UTSW 3 153929528 splice site probably benign
Predicted Primers PCR Primer
(F):5'- GACACAACCAGACTTTTGTTCC -3'
(R):5'- CACACAGGAAAATTGGCATTTGTG -3'

Sequencing Primer
(F):5'- CAACCAGACTTTTGTTCCAAGTTAG -3'
(R):5'- GGCATTTGTGCAAGCTTTGAAACC -3'
Posted On2016-07-06