Incidental Mutation 'R5194:Rab2a'
ID399939
Institutional Source Beutler Lab
Gene Symbol Rab2a
Ensembl Gene ENSMUSG00000047187
Gene NameRAB2A, member RAS oncogene family
SynonymsRab2, 9330148M11Rik
MMRRC Submission 042770-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5194 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location8535644-8607778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8604381 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 161 (I161N)
Ref Sequence ENSEMBL: ENSMUSP00000057664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060232]
Predicted Effect probably benign
Transcript: ENSMUST00000060232
AA Change: I161N

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000057664
Gene: ENSMUSG00000047187
AA Change: I161N

DomainStartEndE-ValueType
RAB 7 170 1e-110 SMART
low complexity region 195 210 N/A INTRINSIC
Meta Mutation Damage Score 0.1144 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Rab family, members of which are small molecular weight guanosine triphosphatases (GTPases) that contain highly conserved domains involved in GTP binding and hydrolysis. The Rabs are membrane-bound proteins, involved in vesicular fusion and trafficking. This protein is a resident of pre-Golgi intermediates, and is required for protein transport from the endoplasmic reticulum (ER) to the Golgi complex. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,250 N82D probably benign Het
Acadm C T 3: 153,933,118 R206H possibly damaging Het
Acly T A 11: 100,523,546 Y18F probably benign Het
Acnat2 G T 4: 49,380,452 Q291K probably benign Het
Agtpbp1 T C 13: 59,500,639 I456V probably benign Het
Ankrd7 A G 6: 18,868,077 N114S possibly damaging Het
Arfgef1 A T 1: 10,204,907 L307I probably benign Het
Arhgef2 A T 3: 88,635,649 I383F probably damaging Het
Cbs C T 17: 31,624,224 probably null Het
Cep135 T C 5: 76,615,777 V538A probably benign Het
D11Wsu47e T C 11: 113,688,828 S350P possibly damaging Het
Dennd5a T C 7: 109,933,729 E254G probably damaging Het
Drc7 T C 8: 95,061,717 V236A probably benign Het
Dtna C T 18: 23,590,245 Q169* probably null Het
Egfem1 G A 3: 29,357,196 probably null Het
Eif2ak3 T C 6: 70,858,478 S130P possibly damaging Het
Ewsr1 T C 11: 5,082,355 N297S unknown Het
F13a1 T G 13: 36,972,063 D192A probably damaging Het
Fam120a A G 13: 48,880,935 V1067A probably benign Het
Gm13124 A G 4: 144,555,082 V380A probably benign Het
Gm17490 T C 2: 11,626,251 Y5C unknown Het
Gm8587 C T 12: 88,089,786 noncoding transcript Het
H2-Ab1 C T 17: 34,269,378 probably benign Het
Hoxd12 T C 2: 74,675,103 L6P probably damaging Het
Ifi204 C T 1: 173,749,344 D564N possibly damaging Het
Irak2 T C 6: 113,690,790 V444A probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrba A C 3: 86,328,219 N877H probably damaging Het
Mylk3 T C 8: 85,352,866 I388V probably benign Het
Myo9b C T 8: 71,349,089 A1286V probably benign Het
Myt1l A C 12: 29,811,648 D143A unknown Het
Ngfr T C 11: 95,580,982 N63S probably benign Het
Olfr1264 T A 2: 90,021,526 Y180F probably damaging Het
Olfr1347 A G 7: 6,488,520 L118P probably damaging Het
Olfr576 A G 7: 102,965,864 I255V probably benign Het
Olfr698 A T 7: 106,753,219 H56Q probably benign Het
Olfr814 C T 10: 129,874,098 V220I probably benign Het
P2rx7 T C 5: 122,673,795 S390P probably benign Het
Pcdhga4 A C 18: 37,687,741 Q781P probably benign Het
Phip G A 9: 82,908,862 S677F probably benign Het
Ptpdc1 C A 13: 48,586,789 V389F possibly damaging Het
Rnf113a2 T A 12: 84,417,337 M1K probably null Het
Schip1 T C 3: 68,494,872 V122A probably benign Het
Sdr16c5 C A 4: 4,006,663 A210S probably benign Het
Sh3bp1 A G 15: 78,903,101 K83E probably damaging Het
Sipa1l2 T C 8: 125,439,273 S1541G possibly damaging Het
Slc22a21 T C 11: 53,979,847 Y4C probably damaging Het
Smco1 C T 16: 32,273,774 H88Y probably damaging Het
Tll2 T C 19: 41,095,897 D697G probably damaging Het
Trim34a A G 7: 104,260,993 N334S possibly damaging Het
Ubqln1 A G 13: 58,199,033 I64T probably benign Het
Vstm2b T A 7: 40,902,488 probably null Het
Wdr17 A G 8: 54,687,604 F238L probably damaging Het
Wiz T C 17: 32,377,848 probably benign Het
Zfp407 T C 18: 84,561,309 S560G probably benign Het
Other mutations in Rab2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01549:Rab2a APN 4 8582393 missense probably benign 0.02
IGL02420:Rab2a APN 4 8572553 missense possibly damaging 0.91
IGL03226:Rab2a APN 4 8606448 missense probably benign
R0331:Rab2a UTSW 4 8572559 missense probably benign
R1627:Rab2a UTSW 4 8578481 missense probably damaging 1.00
R8017:Rab2a UTSW 4 8604444 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTTTCTCAGCGTCCTGGTTAGAG -3'
(R):5'- CTAATGTGCCAATGGATGACC -3'

Sequencing Primer
(F):5'- ATTCCCTAGAGCTGGAGTTACAG -3'
(R):5'- GGATGACCAACTGAACCATTTTAG -3'
Posted On2016-07-06