Incidental Mutation 'R5194:Cep135'
ID399945
Institutional Source Beutler Lab
Gene Symbol Cep135
Ensembl Gene ENSMUSG00000036403
Gene Namecentrosomal protein 135
SynonymsLOC381644, Cep4
MMRRC Submission 042770-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5194 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location76588698-76646466 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76615777 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 538 (V538A)
Ref Sequence ENSEMBL: ENSMUSP00000112602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049060] [ENSMUST00000121979]
Predicted Effect probably benign
Transcript: ENSMUST00000049060
AA Change: V538A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000038674
Gene: ENSMUSG00000036403
AA Change: V538A

DomainStartEndE-ValueType
internal_repeat_1 47 71 1.87e-5 PROSPERO
low complexity region 78 92 N/A INTRINSIC
internal_repeat_1 100 124 1.87e-5 PROSPERO
coiled coil region 125 153 N/A INTRINSIC
coiled coil region 194 245 N/A INTRINSIC
coiled coil region 267 420 N/A INTRINSIC
coiled coil region 445 470 N/A INTRINSIC
Blast:HAMP 492 527 5e-11 BLAST
Blast:SPEC 760 863 6e-21 BLAST
low complexity region 1060 1072 N/A INTRINSIC
coiled coil region 1075 1117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121979
AA Change: V538A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112602
Gene: ENSMUSG00000036403
AA Change: V538A

DomainStartEndE-ValueType
internal_repeat_1 47 71 1.87e-5 PROSPERO
low complexity region 78 92 N/A INTRINSIC
internal_repeat_1 100 124 1.87e-5 PROSPERO
coiled coil region 125 153 N/A INTRINSIC
coiled coil region 194 245 N/A INTRINSIC
coiled coil region 267 420 N/A INTRINSIC
coiled coil region 445 470 N/A INTRINSIC
Blast:HAMP 492 527 5e-11 BLAST
Blast:SPEC 760 863 6e-21 BLAST
low complexity region 1060 1072 N/A INTRINSIC
coiled coil region 1075 1117 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130651
Meta Mutation Damage Score 0.0625 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein, which acts as a scaffolding protein during early centriole biogenesis, and is also required for centriole-centriole cohesion during interphase. Mutations in this gene are associated with autosomal recessive primary microcephaly-8. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,250 N82D probably benign Het
Acadm C T 3: 153,933,118 R206H possibly damaging Het
Acly T A 11: 100,523,546 Y18F probably benign Het
Acnat2 G T 4: 49,380,452 Q291K probably benign Het
Agtpbp1 T C 13: 59,500,639 I456V probably benign Het
Ankrd7 A G 6: 18,868,077 N114S possibly damaging Het
Arfgef1 A T 1: 10,204,907 L307I probably benign Het
Arhgef2 A T 3: 88,635,649 I383F probably damaging Het
Cbs C T 17: 31,624,224 probably null Het
D11Wsu47e T C 11: 113,688,828 S350P possibly damaging Het
Dennd5a T C 7: 109,933,729 E254G probably damaging Het
Drc7 T C 8: 95,061,717 V236A probably benign Het
Dtna C T 18: 23,590,245 Q169* probably null Het
Egfem1 G A 3: 29,357,196 probably null Het
Eif2ak3 T C 6: 70,858,478 S130P possibly damaging Het
Ewsr1 T C 11: 5,082,355 N297S unknown Het
F13a1 T G 13: 36,972,063 D192A probably damaging Het
Fam120a A G 13: 48,880,935 V1067A probably benign Het
Gm13124 A G 4: 144,555,082 V380A probably benign Het
Gm17490 T C 2: 11,626,251 Y5C unknown Het
Gm8587 C T 12: 88,089,786 noncoding transcript Het
H2-Ab1 C T 17: 34,269,378 probably benign Het
Hoxd12 T C 2: 74,675,103 L6P probably damaging Het
Ifi204 C T 1: 173,749,344 D564N possibly damaging Het
Irak2 T C 6: 113,690,790 V444A probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrba A C 3: 86,328,219 N877H probably damaging Het
Mylk3 T C 8: 85,352,866 I388V probably benign Het
Myo9b C T 8: 71,349,089 A1286V probably benign Het
Myt1l A C 12: 29,811,648 D143A unknown Het
Ngfr T C 11: 95,580,982 N63S probably benign Het
Olfr1264 T A 2: 90,021,526 Y180F probably damaging Het
Olfr1347 A G 7: 6,488,520 L118P probably damaging Het
Olfr576 A G 7: 102,965,864 I255V probably benign Het
Olfr698 A T 7: 106,753,219 H56Q probably benign Het
Olfr814 C T 10: 129,874,098 V220I probably benign Het
P2rx7 T C 5: 122,673,795 S390P probably benign Het
Pcdhga4 A C 18: 37,687,741 Q781P probably benign Het
Phip G A 9: 82,908,862 S677F probably benign Het
Ptpdc1 C A 13: 48,586,789 V389F possibly damaging Het
Rab2a T A 4: 8,604,381 I161N probably benign Het
Rnf113a2 T A 12: 84,417,337 M1K probably null Het
Schip1 T C 3: 68,494,872 V122A probably benign Het
Sdr16c5 C A 4: 4,006,663 A210S probably benign Het
Sh3bp1 A G 15: 78,903,101 K83E probably damaging Het
Sipa1l2 T C 8: 125,439,273 S1541G possibly damaging Het
Slc22a21 T C 11: 53,979,847 Y4C probably damaging Het
Smco1 C T 16: 32,273,774 H88Y probably damaging Het
Tll2 T C 19: 41,095,897 D697G probably damaging Het
Trim34a A G 7: 104,260,993 N334S possibly damaging Het
Ubqln1 A G 13: 58,199,033 I64T probably benign Het
Vstm2b T A 7: 40,902,488 probably null Het
Wdr17 A G 8: 54,687,604 F238L probably damaging Het
Wiz T C 17: 32,377,848 probably benign Het
Zfp407 T C 18: 84,561,309 S560G probably benign Het
Other mutations in Cep135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Cep135 APN 5 76601459 missense probably damaging 0.98
IGL01154:Cep135 APN 5 76606796 splice site probably benign
IGL01323:Cep135 APN 5 76591765 missense probably benign 0.29
IGL01599:Cep135 APN 5 76593347 missense possibly damaging 0.93
IGL01923:Cep135 APN 5 76640982 makesense probably null
IGL02178:Cep135 APN 5 76595474 missense probably damaging 1.00
IGL02276:Cep135 APN 5 76634246 missense probably benign 0.00
IGL02344:Cep135 APN 5 76616821 missense probably benign
IGL02394:Cep135 APN 5 76631471 missense probably benign 0.02
IGL02740:Cep135 APN 5 76638268 critical splice donor site probably null
IGL02832:Cep135 APN 5 76640949 missense probably damaging 0.98
R0026:Cep135 UTSW 5 76606734 nonsense probably null
R0060:Cep135 UTSW 5 76621350 missense probably benign 0.20
R0325:Cep135 UTSW 5 76615743 missense probably damaging 0.98
R0336:Cep135 UTSW 5 76601502 missense probably benign 0.07
R0564:Cep135 UTSW 5 76615710 missense probably damaging 1.00
R0564:Cep135 UTSW 5 76638949 missense probably benign 0.03
R0600:Cep135 UTSW 5 76621305 missense probably benign
R0636:Cep135 UTSW 5 76615657 missense probably benign 0.07
R0704:Cep135 UTSW 5 76630949 missense possibly damaging 0.62
R0835:Cep135 UTSW 5 76615706 missense probably benign 0.40
R1015:Cep135 UTSW 5 76640997 critical splice donor site probably null
R1167:Cep135 UTSW 5 76624637 missense probably damaging 1.00
R1252:Cep135 UTSW 5 76594115 missense possibly damaging 0.67
R1554:Cep135 UTSW 5 76634213 nonsense probably null
R1770:Cep135 UTSW 5 76603195 missense possibly damaging 0.95
R1804:Cep135 UTSW 5 76636932 missense probably benign 0.22
R1968:Cep135 UTSW 5 76624747 missense possibly damaging 0.96
R1987:Cep135 UTSW 5 76597428 missense probably benign 0.00
R1996:Cep135 UTSW 5 76632266 missense probably benign 0.08
R2004:Cep135 UTSW 5 76632329 critical splice donor site probably null
R2178:Cep135 UTSW 5 76631450 missense probably benign 0.00
R2305:Cep135 UTSW 5 76595389 splice site probably benign
R2679:Cep135 UTSW 5 76624660 missense probably benign
R3125:Cep135 UTSW 5 76621363 critical splice donor site probably null
R3623:Cep135 UTSW 5 76624739 missense probably benign 0.00
R4359:Cep135 UTSW 5 76611714 missense possibly damaging 0.47
R4407:Cep135 UTSW 5 76624667 missense probably benign
R4561:Cep135 UTSW 5 76638193 missense possibly damaging 0.95
R4666:Cep135 UTSW 5 76616854 missense probably benign
R4945:Cep135 UTSW 5 76597428 missense probably benign 0.00
R5105:Cep135 UTSW 5 76594092 missense probably benign 0.00
R5117:Cep135 UTSW 5 76631429 missense probably benign 0.01
R5176:Cep135 UTSW 5 76637026 missense probably benign 0.04
R5233:Cep135 UTSW 5 76591843 small deletion probably benign
R5275:Cep135 UTSW 5 76593204 missense possibly damaging 0.94
R5295:Cep135 UTSW 5 76593204 missense possibly damaging 0.94
R5412:Cep135 UTSW 5 76616862 missense probably benign 0.00
R5427:Cep135 UTSW 5 76638202 missense probably benign 0.00
R5801:Cep135 UTSW 5 76630676 missense probably damaging 1.00
R5975:Cep135 UTSW 5 76640890 missense possibly damaging 0.94
R6087:Cep135 UTSW 5 76615791 critical splice donor site probably null
R6176:Cep135 UTSW 5 76624643 missense probably benign
R6210:Cep135 UTSW 5 76624723 missense probably benign 0.15
R6456:Cep135 UTSW 5 76591724 start gained probably benign
R6467:Cep135 UTSW 5 76621340 missense possibly damaging 0.50
R6622:Cep135 UTSW 5 76640968 missense probably benign 0.00
R6650:Cep135 UTSW 5 76633701 missense possibly damaging 0.77
R6838:Cep135 UTSW 5 76632215 missense probably damaging 1.00
R7028:Cep135 UTSW 5 76616848 missense probably benign
R7049:Cep135 UTSW 5 76606738 missense probably benign 0.01
R7095:Cep135 UTSW 5 76594058 missense probably benign 0.10
R7207:Cep135 UTSW 5 76632243 missense probably benign 0.00
R7330:Cep135 UTSW 5 76606745 nonsense probably null
R7369:Cep135 UTSW 5 76593253 missense possibly damaging 0.94
R7741:Cep135 UTSW 5 76630970 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCACCAGCAGGATTGTGAC -3'
(R):5'- CTGCCACACTGACAAGCTAG -3'

Sequencing Primer
(F):5'- GATTGTGACAACCATGCAGTC -3'
(R):5'- TGCCACACTGACAAGCTAGAAAAG -3'
Posted On2016-07-06