Incidental Mutation 'R5194:Irak2'
ID399953
Institutional Source Beutler Lab
Gene Symbol Irak2
Ensembl Gene ENSMUSG00000060477
Gene Nameinterleukin-1 receptor-associated kinase 2
Synonyms6330415L08Rik, IRAK-2
MMRRC Submission 042770-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5194 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location113638467-113695026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113690790 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 444 (V444A)
Ref Sequence ENSEMBL: ENSMUSP00000086416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059286] [ENSMUST00000089022] [ENSMUST00000089023]
Predicted Effect probably benign
Transcript: ENSMUST00000059286
AA Change: V492A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055073
Gene: ENSMUSG00000060477
AA Change: V492A

DomainStartEndE-ValueType
Pfam:Death 14 94 4.8e-16 PFAM
Pfam:Pkinase 208 473 4.8e-28 PFAM
Pfam:Pkinase_Tyr 208 482 1.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089022
AA Change: V444A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000086416
Gene: ENSMUSG00000060477
AA Change: V444A

DomainStartEndE-ValueType
Pfam:Death 14 93 3.9e-16 PFAM
Pfam:Pkinase 160 425 1.3e-30 PFAM
Pfam:Pkinase_Tyr 160 436 1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089023
SMART Domains Protein: ENSMUSP00000086417
Gene: ENSMUSG00000060477

DomainStartEndE-ValueType
PDB:3MOP|N 2 35 3e-13 PDB
Pfam:Pkinase 147 412 1.2e-30 PFAM
Pfam:Pkinase_Tyr 147 419 9.8e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113024
SMART Domains Protein: ENSMUSP00000108647
Gene: ENSMUSG00000060477

DomainStartEndE-ValueType
Pfam:Pkinase 65 330 1.4e-30 PFAM
Pfam:Pkinase_Tyr 65 342 1.1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204352
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IRAK2 encodes the interleukin-1 receptor-associated kinase 2, one of two putative serine/threonine kinases that become associated with the interleukin-1 receptor (IL1R) upon stimulation. IRAK2 is reported to participate in the IL1-induced upregulation of NF-kappaB. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased susceptibility to endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,250 N82D probably benign Het
Acadm C T 3: 153,933,118 R206H possibly damaging Het
Acly T A 11: 100,523,546 Y18F probably benign Het
Acnat2 G T 4: 49,380,452 Q291K probably benign Het
Agtpbp1 T C 13: 59,500,639 I456V probably benign Het
Ankrd7 A G 6: 18,868,077 N114S possibly damaging Het
Arfgef1 A T 1: 10,204,907 L307I probably benign Het
Arhgef2 A T 3: 88,635,649 I383F probably damaging Het
Cbs C T 17: 31,624,224 probably null Het
Cep135 T C 5: 76,615,777 V538A probably benign Het
D11Wsu47e T C 11: 113,688,828 S350P possibly damaging Het
Dennd5a T C 7: 109,933,729 E254G probably damaging Het
Drc7 T C 8: 95,061,717 V236A probably benign Het
Dtna C T 18: 23,590,245 Q169* probably null Het
Egfem1 G A 3: 29,357,196 probably null Het
Eif2ak3 T C 6: 70,858,478 S130P possibly damaging Het
Ewsr1 T C 11: 5,082,355 N297S unknown Het
F13a1 T G 13: 36,972,063 D192A probably damaging Het
Fam120a A G 13: 48,880,935 V1067A probably benign Het
Gm13124 A G 4: 144,555,082 V380A probably benign Het
Gm17490 T C 2: 11,626,251 Y5C unknown Het
Gm8587 C T 12: 88,089,786 noncoding transcript Het
H2-Ab1 C T 17: 34,269,378 probably benign Het
Hoxd12 T C 2: 74,675,103 L6P probably damaging Het
Ifi204 C T 1: 173,749,344 D564N possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrba A C 3: 86,328,219 N877H probably damaging Het
Mylk3 T C 8: 85,352,866 I388V probably benign Het
Myo9b C T 8: 71,349,089 A1286V probably benign Het
Myt1l A C 12: 29,811,648 D143A unknown Het
Ngfr T C 11: 95,580,982 N63S probably benign Het
Olfr1264 T A 2: 90,021,526 Y180F probably damaging Het
Olfr1347 A G 7: 6,488,520 L118P probably damaging Het
Olfr576 A G 7: 102,965,864 I255V probably benign Het
Olfr698 A T 7: 106,753,219 H56Q probably benign Het
Olfr814 C T 10: 129,874,098 V220I probably benign Het
P2rx7 T C 5: 122,673,795 S390P probably benign Het
Pcdhga4 A C 18: 37,687,741 Q781P probably benign Het
Phip G A 9: 82,908,862 S677F probably benign Het
Ptpdc1 C A 13: 48,586,789 V389F possibly damaging Het
Rab2a T A 4: 8,604,381 I161N probably benign Het
Rnf113a2 T A 12: 84,417,337 M1K probably null Het
Schip1 T C 3: 68,494,872 V122A probably benign Het
Sdr16c5 C A 4: 4,006,663 A210S probably benign Het
Sh3bp1 A G 15: 78,903,101 K83E probably damaging Het
Sipa1l2 T C 8: 125,439,273 S1541G possibly damaging Het
Slc22a21 T C 11: 53,979,847 Y4C probably damaging Het
Smco1 C T 16: 32,273,774 H88Y probably damaging Het
Tll2 T C 19: 41,095,897 D697G probably damaging Het
Trim34a A G 7: 104,260,993 N334S possibly damaging Het
Ubqln1 A G 13: 58,199,033 I64T probably benign Het
Vstm2b T A 7: 40,902,488 probably null Het
Wdr17 A G 8: 54,687,604 F238L probably damaging Het
Wiz T C 17: 32,377,848 probably benign Het
Zfp407 T C 18: 84,561,309 S560G probably benign Het
Other mutations in Irak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Irak2 APN 6 113678675 missense probably benign 0.41
IGL03026:Irak2 APN 6 113676651 missense probably damaging 1.00
R0047:Irak2 UTSW 6 113672953 splice site probably benign
R0047:Irak2 UTSW 6 113678738 missense probably benign 0.43
R0658:Irak2 UTSW 6 113638564 missense probably damaging 1.00
R1120:Irak2 UTSW 6 113675759 unclassified probably benign
R2143:Irak2 UTSW 6 113672827 missense probably benign 0.03
R2190:Irak2 UTSW 6 113686943 missense probably damaging 1.00
R2342:Irak2 UTSW 6 113693671 missense probably benign 0.08
R2507:Irak2 UTSW 6 113647678 missense probably damaging 1.00
R3160:Irak2 UTSW 6 113672760 missense probably benign 0.18
R3162:Irak2 UTSW 6 113672760 missense probably benign 0.18
R4231:Irak2 UTSW 6 113690856 missense probably damaging 0.98
R4604:Irak2 UTSW 6 113672887 missense probably damaging 1.00
R4772:Irak2 UTSW 6 113693722 missense probably damaging 1.00
R4940:Irak2 UTSW 6 113693730 missense probably benign 0.41
R5082:Irak2 UTSW 6 113672844 missense probably damaging 1.00
R5118:Irak2 UTSW 6 113665811 missense probably benign 0.00
R5604:Irak2 UTSW 6 113690831 missense possibly damaging 0.91
R5928:Irak2 UTSW 6 113676626 missense probably damaging 1.00
R6479:Irak2 UTSW 6 113686941 missense probably damaging 0.99
R7102:Irak2 UTSW 6 113686849 missense probably damaging 1.00
R7153:Irak2 UTSW 6 113678709 missense probably benign 0.34
R7199:Irak2 UTSW 6 113673084 missense probably damaging 0.99
R7509:Irak2 UTSW 6 113690898 frame shift probably null
R7694:Irak2 UTSW 6 113690898 missense probably damaging 1.00
R7716:Irak2 UTSW 6 113690898 frame shift probably null
R8414:Irak2 UTSW 6 113686942 missense probably benign 0.08
R8750:Irak2 UTSW 6 113686822 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGAAAGGACCGGCATGGAC -3'
(R):5'- ATGTCCCGTGAAGAGTGGAG -3'

Sequencing Primer
(F):5'- ATCCTGACTGAGCATATTAGCC -3'
(R):5'- TGGAGAGGAGGCAGCCC -3'
Posted On2016-07-06