Incidental Mutation 'R5268:Car4'
ID399962
Institutional Source Beutler Lab
Gene Symbol Car4
Ensembl Gene ENSMUSG00000000805
Gene Namecarbonic anhydrase 4
SynonymsCA IV
MMRRC Submission 042860-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R5268 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location84957786-84966044 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 84965800 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 305 (Q305K)
Ref Sequence ENSEMBL: ENSMUSP00000099483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103194] [ENSMUST00000127827] [ENSMUST00000150596]
PDB Structure
MURINE CARBONIC ANHYDRASE IV [X-RAY DIFFRACTION]
MURINE CARBONIC ANHYDRASE IV COMPLEXED WITH BRINZOLAMIDE [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000103194
AA Change: Q305K

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099483
Gene: ENSMUSG00000000805
AA Change: Q305K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Carb_anhydrase 22 278 2.37e-103 SMART
low complexity region 283 299 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000108076
AA Change: Q163K
SMART Domains Protein: ENSMUSP00000103711
Gene: ENSMUSG00000000805
AA Change: Q163K

DomainStartEndE-ValueType
Carb_anhydrase 3 137 9.49e-7 SMART
low complexity region 142 158 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139416
Predicted Effect probably benign
Transcript: ENSMUST00000150596
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. This gene encodes a glycosylphosphatidyl-inositol-anchored membrane isozyme expressed on the luminal surfaces of pulmonary (and certain other) capillaries and proximal renal tubules. Its exact function is not known; however, it may have a role in inherited renal abnormalities of bicarbonate transport. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are produced in lower than expected numbers, with females preferentially lost in the fetal or early postnatal period. Surviving homozygotes are healthy and fertile when crossed with wild-type partners; however, homozygous intercrosses yield small litters and pups do not survive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810032O08Rik G T 11: 116,671,756 M18I probably benign Het
Adamtsl4 C A 3: 95,680,163 R701L probably damaging Het
Adgrf5 T C 17: 43,450,999 V1195A probably damaging Het
Agpat5 A G 8: 18,881,862 T333A possibly damaging Het
Aspm G T 1: 139,464,295 G795C probably damaging Het
Catsperg1 T C 7: 29,195,247 N612S probably benign Het
Cdc5l G A 17: 45,415,585 R354W probably damaging Het
Cdh9 G A 15: 16,851,013 V623I probably benign Het
Cfap65 A G 1: 74,924,902 V629A probably benign Het
Chd1 G A 17: 15,735,743 V535I probably damaging Het
Col12a1 A G 9: 79,678,047 V1316A probably damaging Het
Col6a3 A T 1: 90,785,243 D1721E unknown Het
Cop1 T A 1: 159,327,164 F647L probably damaging Het
Corin A C 5: 72,343,019 S421A probably damaging Het
Crb2 T C 2: 37,790,821 V587A probably damaging Het
Ctc1 T A 11: 69,029,810 V646E possibly damaging Het
Cyp2a12 A T 7: 27,031,218 M203L probably benign Het
Dcdc2c T A 12: 28,516,657 K336M possibly damaging Het
Ddx39 G A 8: 83,722,321 R275H probably benign Het
Des A G 1: 75,362,928 N310S possibly damaging Het
Dlk1 C A 12: 109,459,838 S212R probably benign Het
Dnajc5b A G 3: 19,579,060 E149G probably benign Het
Dpep1 A T 8: 123,194,089 I3F probably benign Het
Eml6 T A 11: 29,803,108 R934S probably benign Het
Ercc6l2 T C 13: 63,869,111 L676P possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Frem2 T A 3: 53,653,154 I1311F probably damaging Het
Gldc T A 19: 30,145,725 M257L probably damaging Het
Gm5538 A G 3: 59,752,023 E299G probably damaging Het
Gm8674 T G 13: 49,901,354 noncoding transcript Het
Gnai3 C T 3: 108,123,541 probably null Het
Gtf3a A G 5: 146,955,155 D300G probably damaging Het
Haus3 A T 5: 34,166,105 V387D probably damaging Het
Hpf1 T A 8: 60,893,734 F28I possibly damaging Het
Iars A G 13: 49,690,491 D147G probably damaging Het
Ibtk A T 9: 85,743,690 D2E probably benign Het
Ift140 T A 17: 25,020,627 I86K possibly damaging Het
Igf2bp2 T A 16: 22,079,491 I235F probably damaging Het
Ighv3-8 G T 12: 114,322,632 A30E probably benign Het
Kcnq5 T A 1: 21,505,725 T252S probably damaging Het
Lrrc4b A T 7: 44,461,363 N220Y probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mamdc4 T C 2: 25,564,690 T1037A possibly damaging Het
Mbd5 A T 2: 49,272,094 I863F possibly damaging Het
Muc4 T A 16: 32,751,666 S515T possibly damaging Het
Mylk4 T A 13: 32,708,881 probably null Het
Neu4 G A 1: 94,024,947 R346H probably benign Het
Nxpe5 T A 5: 138,239,938 Y253* probably null Het
Olfml2b A T 1: 170,649,761 E155V probably damaging Het
Olfr160 T A 9: 37,712,004 I92F probably damaging Het
Olfr2 T A 7: 107,000,904 N319Y probably benign Het
Olfr304 A G 7: 86,385,659 *334Q probably null Het
Pamr1 G A 2: 102,586,684 A114T probably damaging Het
Pdzd2 T A 15: 12,592,177 N127I probably damaging Het
Pglyrp4 C T 3: 90,726,964 L5F probably damaging Het
Plce1 T A 19: 38,758,835 S1667T possibly damaging Het
Qser1 A T 2: 104,787,431 V1012E possibly damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rcn3 A T 7: 45,086,779 D168E probably damaging Het
Rdh1 T G 10: 127,759,963 V9G possibly damaging Het
Rin2 A G 2: 145,844,760 T70A probably benign Het
Rnf207 T C 4: 152,313,889 D276G probably damaging Het
Rtel1 C T 2: 181,340,561 S368L probably benign Het
Slc15a5 C A 6: 138,079,753 C55F probably damaging Het
Slc36a4 T C 9: 15,726,916 F213L possibly damaging Het
Spata25 C T 2: 164,828,034 G19D probably damaging Het
St5 A G 7: 109,557,312 L77P probably benign Het
Tas2r102 A T 6: 132,762,397 L89F probably damaging Het
Tbc1d1 A G 5: 64,324,567 K704E probably damaging Het
Tert T G 13: 73,627,354 S75A probably damaging Het
Tiparp T A 3: 65,547,565 L195Q possibly damaging Het
Tmem205 A C 9: 21,926,084 Y57* probably null Het
Tomm22 A G 15: 79,671,227 R5G probably benign Het
Trav10 A T 14: 53,506,058 S39C probably benign Het
Trav6-2 T A 14: 52,667,748 N75K probably benign Het
Trio T C 15: 27,748,286 S2427G probably benign Het
Ttc41 C A 10: 86,744,478 H763N possibly damaging Het
Usp29 A T 7: 6,961,584 N142I probably damaging Het
Vmn1r204 G T 13: 22,556,742 W181L probably damaging Het
Vmn2r76 G A 7: 86,226,059 T570M probably damaging Het
Wdr90 A G 17: 25,850,845 L1173P probably damaging Het
Wnt9a T A 11: 59,328,570 C141S probably damaging Het
Zfp462 A T 4: 55,012,299 I1422L probably benign Het
Other mutations in Car4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Car4 APN 11 84965767 missense probably damaging 1.00
IGL01121:Car4 APN 11 84964346 critical splice acceptor site probably null
IGL01828:Car4 APN 11 84964745 missense probably benign 0.19
IGL02340:Car4 APN 11 84965767 missense probably damaging 1.00
IGL02351:Car4 APN 11 84965767 missense probably damaging 1.00
IGL02353:Car4 APN 11 84965767 missense probably damaging 1.00
IGL02358:Car4 APN 11 84965767 missense probably damaging 1.00
IGL02360:Car4 APN 11 84965767 missense probably damaging 1.00
PIT4802001:Car4 UTSW 11 84964405 missense probably damaging 1.00
R0008:Car4 UTSW 11 84963411 unclassified probably benign
R0501:Car4 UTSW 11 84963442 missense probably benign 0.01
R2124:Car4 UTSW 11 84964085 splice site probably benign
R3907:Car4 UTSW 11 84964357 missense probably damaging 1.00
R5072:Car4 UTSW 11 84963367 missense probably benign
R5562:Car4 UTSW 11 84964098 missense probably benign 0.05
R6508:Car4 UTSW 11 84965643 missense possibly damaging 0.64
R7775:Car4 UTSW 11 84965623 missense probably damaging 1.00
Z1177:Car4 UTSW 11 84963419 missense not run
Predicted Primers PCR Primer
(F):5'- GAGCCCAGTCTCTTTCACAG -3'
(R):5'- AGGGCAATTGCAGAGAATTACC -3'

Sequencing Primer
(F):5'- AGTCTCTTTCACAGTTCCTGGAATTC -3'
(R):5'- GAGGTCAGAGATCCACATGTCC -3'
Posted On2016-07-06