Incidental Mutation 'R5194:Mylk3'
ID399972
Institutional Source Beutler Lab
Gene Symbol Mylk3
Ensembl Gene ENSMUSG00000031698
Gene Namemyosin light chain kinase 3
Synonyms
MMRRC Submission 042770-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R5194 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location85324303-85386345 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85352866 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 388 (I388V)
Ref Sequence ENSEMBL: ENSMUSP00000113389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034133] [ENSMUST00000121972] [ENSMUST00000122452]
Predicted Effect probably benign
Transcript: ENSMUST00000034133
AA Change: I521V

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000034133
Gene: ENSMUSG00000031698
AA Change: I521V

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 304 316 N/A INTRINSIC
S_TKc 491 746 6.93e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121972
AA Change: I458V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113960
Gene: ENSMUSG00000031698
AA Change: I458V

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
S_TKc 428 683 6.93e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122452
AA Change: I388V

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113389
Gene: ENSMUSG00000031698
AA Change: I388V

DomainStartEndE-ValueType
low complexity region 171 183 N/A INTRINSIC
S_TKc 358 613 6.93e-91 SMART
Meta Mutation Damage Score 0.0656 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylation of cardiac myosin heavy chains (see MYH7B, MIM 609928) and light chains (see MYL2, MIM 160781) by a kinase, such as MYLK3, potentiates the force and rate of cross-bridge recruitment in cardiac myocytes (Chan et al., 2008 [PubMed 18202317]).[supplied by OMIM, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit cardiac hypertrophy, reduced cardiac function and increased response of heart to induced stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,250 N82D probably benign Het
Acadm C T 3: 153,933,118 R206H possibly damaging Het
Acly T A 11: 100,523,546 Y18F probably benign Het
Acnat2 G T 4: 49,380,452 Q291K probably benign Het
Agtpbp1 T C 13: 59,500,639 I456V probably benign Het
Ankrd7 A G 6: 18,868,077 N114S possibly damaging Het
Arfgef1 A T 1: 10,204,907 L307I probably benign Het
Arhgef2 A T 3: 88,635,649 I383F probably damaging Het
Cbs C T 17: 31,624,224 probably null Het
Cep135 T C 5: 76,615,777 V538A probably benign Het
D11Wsu47e T C 11: 113,688,828 S350P possibly damaging Het
Dennd5a T C 7: 109,933,729 E254G probably damaging Het
Drc7 T C 8: 95,061,717 V236A probably benign Het
Dtna C T 18: 23,590,245 Q169* probably null Het
Egfem1 G A 3: 29,357,196 probably null Het
Eif2ak3 T C 6: 70,858,478 S130P possibly damaging Het
Ewsr1 T C 11: 5,082,355 N297S unknown Het
F13a1 T G 13: 36,972,063 D192A probably damaging Het
Fam120a A G 13: 48,880,935 V1067A probably benign Het
Gm13124 A G 4: 144,555,082 V380A probably benign Het
Gm17490 T C 2: 11,626,251 Y5C unknown Het
Gm8587 C T 12: 88,089,786 noncoding transcript Het
H2-Ab1 C T 17: 34,269,378 probably benign Het
Hoxd12 T C 2: 74,675,103 L6P probably damaging Het
Ifi204 C T 1: 173,749,344 D564N possibly damaging Het
Irak2 T C 6: 113,690,790 V444A probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrba A C 3: 86,328,219 N877H probably damaging Het
Myo9b C T 8: 71,349,089 A1286V probably benign Het
Myt1l A C 12: 29,811,648 D143A unknown Het
Ngfr T C 11: 95,580,982 N63S probably benign Het
Olfr1264 T A 2: 90,021,526 Y180F probably damaging Het
Olfr1347 A G 7: 6,488,520 L118P probably damaging Het
Olfr576 A G 7: 102,965,864 I255V probably benign Het
Olfr698 A T 7: 106,753,219 H56Q probably benign Het
Olfr814 C T 10: 129,874,098 V220I probably benign Het
P2rx7 T C 5: 122,673,795 S390P probably benign Het
Pcdhga4 A C 18: 37,687,741 Q781P probably benign Het
Phip G A 9: 82,908,862 S677F probably benign Het
Ptpdc1 C A 13: 48,586,789 V389F possibly damaging Het
Rab2a T A 4: 8,604,381 I161N probably benign Het
Rnf113a2 T A 12: 84,417,337 M1K probably null Het
Schip1 T C 3: 68,494,872 V122A probably benign Het
Sdr16c5 C A 4: 4,006,663 A210S probably benign Het
Sh3bp1 A G 15: 78,903,101 K83E probably damaging Het
Sipa1l2 T C 8: 125,439,273 S1541G possibly damaging Het
Slc22a21 T C 11: 53,979,847 Y4C probably damaging Het
Smco1 C T 16: 32,273,774 H88Y probably damaging Het
Tll2 T C 19: 41,095,897 D697G probably damaging Het
Trim34a A G 7: 104,260,993 N334S possibly damaging Het
Ubqln1 A G 13: 58,199,033 I64T probably benign Het
Vstm2b T A 7: 40,902,488 probably null Het
Wdr17 A G 8: 54,687,604 F238L probably damaging Het
Wiz T C 17: 32,377,848 probably benign Het
Zfp407 T C 18: 84,561,309 S560G probably benign Het
Other mutations in Mylk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Mylk3 APN 8 85355526 nonsense probably null
IGL01088:Mylk3 APN 8 85351957 splice site probably null
IGL01431:Mylk3 APN 8 85336401 missense probably damaging 1.00
IGL01488:Mylk3 APN 8 85352027 missense probably damaging 1.00
IGL01550:Mylk3 APN 8 85365089 missense probably damaging 1.00
IGL01786:Mylk3 APN 8 85359317 missense probably benign 0.27
IGL01877:Mylk3 APN 8 85359042 missense possibly damaging 0.66
IGL01995:Mylk3 APN 8 85359261 missense possibly damaging 0.83
IGL02003:Mylk3 APN 8 85359098 missense probably benign
IGL02251:Mylk3 APN 8 85355176 missense probably benign 0.04
IGL02252:Mylk3 APN 8 85355476 missense probably benign 0.04
IGL02341:Mylk3 APN 8 85351972 missense probably damaging 1.00
IGL02352:Mylk3 APN 8 85355302 missense probably benign 0.00
IGL02359:Mylk3 APN 8 85355302 missense probably benign 0.00
IGL03000:Mylk3 APN 8 85359177 missense probably damaging 0.97
IGL03185:Mylk3 APN 8 85327204 missense probably damaging 0.97
IGL03404:Mylk3 APN 8 85342681 missense probably damaging 1.00
R0005:Mylk3 UTSW 8 85327203 missense possibly damaging 0.93
R0219:Mylk3 UTSW 8 85355244 missense probably damaging 0.99
R0324:Mylk3 UTSW 8 85352906 missense probably damaging 0.98
R0402:Mylk3 UTSW 8 85352910 missense probably damaging 1.00
R0667:Mylk3 UTSW 8 85355165 critical splice donor site probably null
R1711:Mylk3 UTSW 8 85364831 missense probably damaging 1.00
R1857:Mylk3 UTSW 8 85328594 missense probably damaging 0.98
R1875:Mylk3 UTSW 8 85352865 missense probably damaging 1.00
R1878:Mylk3 UTSW 8 85355399 missense possibly damaging 0.82
R1916:Mylk3 UTSW 8 85327192 missense probably damaging 1.00
R3887:Mylk3 UTSW 8 85352047 missense probably damaging 1.00
R4081:Mylk3 UTSW 8 85328682 missense probably damaging 1.00
R4775:Mylk3 UTSW 8 85359060 nonsense probably null
R4796:Mylk3 UTSW 8 85350385 missense probably damaging 1.00
R4974:Mylk3 UTSW 8 85364783 missense probably damaging 0.97
R5108:Mylk3 UTSW 8 85359092 missense possibly damaging 0.83
R5276:Mylk3 UTSW 8 85355442 missense probably damaging 1.00
R5296:Mylk3 UTSW 8 85355431 missense possibly damaging 0.66
R5303:Mylk3 UTSW 8 85350476 missense probably damaging 1.00
R5338:Mylk3 UTSW 8 85342721 missense probably damaging 1.00
R5957:Mylk3 UTSW 8 85328637 missense probably damaging 0.98
R6021:Mylk3 UTSW 8 85364813 missense possibly damaging 0.92
R6294:Mylk3 UTSW 8 85350383 missense probably damaging 1.00
R6305:Mylk3 UTSW 8 85350419 missense probably damaging 1.00
R6376:Mylk3 UTSW 8 85358942 missense possibly damaging 0.53
R6970:Mylk3 UTSW 8 85359263 missense probably damaging 0.97
R7081:Mylk3 UTSW 8 85364793 missense probably benign 0.10
R7170:Mylk3 UTSW 8 85350485 missense probably damaging 1.00
R7318:Mylk3 UTSW 8 85359097 missense probably benign
R7422:Mylk3 UTSW 8 85355244 missense probably benign 0.16
R7503:Mylk3 UTSW 8 85353589 missense probably benign 0.00
R7536:Mylk3 UTSW 8 85353604 missense probably benign 0.05
Z1176:Mylk3 UTSW 8 85365179
Z1177:Mylk3 UTSW 8 85359194 missense probably benign 0.14
Z1177:Mylk3 UTSW 8 85365179
Predicted Primers PCR Primer
(F):5'- CTCACACAAATGAGGTCTGGAC -3'
(R):5'- CTAAGGTAACAGCCCACATGG -3'

Sequencing Primer
(F):5'- CTTAGTGTATGGCATGAATCAAGG -3'
(R):5'- ACATGGTGTGTGTACAGAGG -3'
Posted On2016-07-06