Incidental Mutation 'R5194:Sipa1l2'
ID399976
Institutional Source Beutler Lab
Gene Symbol Sipa1l2
Ensembl Gene ENSMUSG00000001995
Gene Namesignal-induced proliferation-associated 1 like 2
Synonyms
MMRRC Submission 042770-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R5194 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location125418063-125569808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125439273 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1541 (S1541G)
Ref Sequence ENSEMBL: ENSMUSP00000148536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108775] [ENSMUST00000212168] [ENSMUST00000212987]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108775
AA Change: S1541G

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104405
Gene: ENSMUSG00000001995
AA Change: S1541G

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 163 172 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
low complexity region 427 449 N/A INTRINSIC
Pfam:Rap_GAP 625 807 2.6e-67 PFAM
PDZ 960 1026 6.47e-9 SMART
low complexity region 1091 1103 N/A INTRINSIC
low complexity region 1120 1138 N/A INTRINSIC
low complexity region 1220 1238 N/A INTRINSIC
low complexity region 1299 1312 N/A INTRINSIC
low complexity region 1321 1329 N/A INTRINSIC
low complexity region 1334 1355 N/A INTRINSIC
low complexity region 1404 1418 N/A INTRINSIC
Pfam:SPAR_C 1421 1666 2.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212168
AA Change: S1541G

PolyPhen 2 Score 0.426 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212987
AA Change: S1541G

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.0617 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-induced proliferation-associated 1 like family. Members of this family contain a GTPase activating domain, a PDZ domain and a C-terminal coiled-coil domain with a leucine zipper. A similar protein in rat acts as a GTPases for the small GTPase Rap. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,250 N82D probably benign Het
Acadm C T 3: 153,933,118 R206H possibly damaging Het
Acly T A 11: 100,523,546 Y18F probably benign Het
Acnat2 G T 4: 49,380,452 Q291K probably benign Het
Agtpbp1 T C 13: 59,500,639 I456V probably benign Het
Ankrd7 A G 6: 18,868,077 N114S possibly damaging Het
Arfgef1 A T 1: 10,204,907 L307I probably benign Het
Arhgef2 A T 3: 88,635,649 I383F probably damaging Het
Cbs C T 17: 31,624,224 probably null Het
Cep135 T C 5: 76,615,777 V538A probably benign Het
D11Wsu47e T C 11: 113,688,828 S350P possibly damaging Het
Dennd5a T C 7: 109,933,729 E254G probably damaging Het
Drc7 T C 8: 95,061,717 V236A probably benign Het
Dtna C T 18: 23,590,245 Q169* probably null Het
Egfem1 G A 3: 29,357,196 probably null Het
Eif2ak3 T C 6: 70,858,478 S130P possibly damaging Het
Ewsr1 T C 11: 5,082,355 N297S unknown Het
F13a1 T G 13: 36,972,063 D192A probably damaging Het
Fam120a A G 13: 48,880,935 V1067A probably benign Het
Gm13124 A G 4: 144,555,082 V380A probably benign Het
Gm17490 T C 2: 11,626,251 Y5C unknown Het
Gm8587 C T 12: 88,089,786 noncoding transcript Het
H2-Ab1 C T 17: 34,269,378 probably benign Het
Hoxd12 T C 2: 74,675,103 L6P probably damaging Het
Ifi204 C T 1: 173,749,344 D564N possibly damaging Het
Irak2 T C 6: 113,690,790 V444A probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrba A C 3: 86,328,219 N877H probably damaging Het
Mylk3 T C 8: 85,352,866 I388V probably benign Het
Myo9b C T 8: 71,349,089 A1286V probably benign Het
Myt1l A C 12: 29,811,648 D143A unknown Het
Ngfr T C 11: 95,580,982 N63S probably benign Het
Olfr1264 T A 2: 90,021,526 Y180F probably damaging Het
Olfr1347 A G 7: 6,488,520 L118P probably damaging Het
Olfr576 A G 7: 102,965,864 I255V probably benign Het
Olfr698 A T 7: 106,753,219 H56Q probably benign Het
Olfr814 C T 10: 129,874,098 V220I probably benign Het
P2rx7 T C 5: 122,673,795 S390P probably benign Het
Pcdhga4 A C 18: 37,687,741 Q781P probably benign Het
Phip G A 9: 82,908,862 S677F probably benign Het
Ptpdc1 C A 13: 48,586,789 V389F possibly damaging Het
Rab2a T A 4: 8,604,381 I161N probably benign Het
Rnf113a2 T A 12: 84,417,337 M1K probably null Het
Schip1 T C 3: 68,494,872 V122A probably benign Het
Sdr16c5 C A 4: 4,006,663 A210S probably benign Het
Sh3bp1 A G 15: 78,903,101 K83E probably damaging Het
Slc22a21 T C 11: 53,979,847 Y4C probably damaging Het
Smco1 C T 16: 32,273,774 H88Y probably damaging Het
Tll2 T C 19: 41,095,897 D697G probably damaging Het
Trim34a A G 7: 104,260,993 N334S possibly damaging Het
Ubqln1 A G 13: 58,199,033 I64T probably benign Het
Vstm2b T A 7: 40,902,488 probably null Het
Wdr17 A G 8: 54,687,604 F238L probably damaging Het
Wiz T C 17: 32,377,848 probably benign Het
Zfp407 T C 18: 84,561,309 S560G probably benign Het
Other mutations in Sipa1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Sipa1l2 APN 8 125491806 missense probably damaging 1.00
IGL00939:Sipa1l2 APN 8 125464435 splice site probably benign
IGL00965:Sipa1l2 APN 8 125447874 missense probably benign 0.02
IGL01321:Sipa1l2 APN 8 125491518 missense probably damaging 1.00
IGL01450:Sipa1l2 APN 8 125422577 critical splice donor site probably null
IGL01753:Sipa1l2 APN 8 125453292 splice site probably benign
IGL01930:Sipa1l2 APN 8 125419239 missense probably damaging 0.99
IGL02041:Sipa1l2 APN 8 125491819 missense probably benign 0.03
IGL02215:Sipa1l2 APN 8 125447837 missense possibly damaging 0.67
IGL02272:Sipa1l2 APN 8 125492011 missense probably damaging 1.00
IGL02370:Sipa1l2 APN 8 125480269 missense probably damaging 1.00
IGL02538:Sipa1l2 APN 8 125451977 missense probably damaging 1.00
IGL02633:Sipa1l2 APN 8 125447768 missense probably damaging 1.00
IGL03394:Sipa1l2 APN 8 125491659 missense possibly damaging 0.67
Rebellious UTSW 8 125468339 missense probably benign 0.01
R0144:Sipa1l2 UTSW 8 125449876 splice site probably null
R0153:Sipa1l2 UTSW 8 125421898 missense probably damaging 0.99
R0276:Sipa1l2 UTSW 8 125421940 missense probably damaging 1.00
R0318:Sipa1l2 UTSW 8 125447697 missense possibly damaging 0.73
R0373:Sipa1l2 UTSW 8 125464410 missense probably damaging 0.99
R0427:Sipa1l2 UTSW 8 125480332 missense probably damaging 1.00
R0634:Sipa1l2 UTSW 8 125422624 nonsense probably null
R1377:Sipa1l2 UTSW 8 125491977 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1435:Sipa1l2 UTSW 8 125468725 missense probably damaging 1.00
R1523:Sipa1l2 UTSW 8 125447613 missense possibly damaging 0.75
R1577:Sipa1l2 UTSW 8 125492262 missense probably benign 0.00
R1581:Sipa1l2 UTSW 8 125491617 missense probably damaging 0.96
R1583:Sipa1l2 UTSW 8 125421895 missense probably damaging 0.97
R1719:Sipa1l2 UTSW 8 125444535 missense probably damaging 0.99
R1730:Sipa1l2 UTSW 8 125480141 splice site probably null
R1940:Sipa1l2 UTSW 8 125480148 splice site probably benign
R2007:Sipa1l2 UTSW 8 125439437 missense probably damaging 1.00
R2141:Sipa1l2 UTSW 8 125491491 missense probably benign 0.07
R2203:Sipa1l2 UTSW 8 125491627 missense probably damaging 0.99
R2764:Sipa1l2 UTSW 8 125492374 missense probably damaging 0.99
R3722:Sipa1l2 UTSW 8 125473584 missense probably damaging 1.00
R3787:Sipa1l2 UTSW 8 125423205 missense probably benign
R3787:Sipa1l2 UTSW 8 125450383 missense possibly damaging 0.52
R4106:Sipa1l2 UTSW 8 125492308 missense probably damaging 1.00
R4117:Sipa1l2 UTSW 8 125468510 missense probably damaging 1.00
R4194:Sipa1l2 UTSW 8 125491672 missense probably benign 0.00
R4237:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4240:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4448:Sipa1l2 UTSW 8 125492355 missense probably damaging 1.00
R4515:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4519:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4523:Sipa1l2 UTSW 8 125492424 missense probably damaging 1.00
R4557:Sipa1l2 UTSW 8 125464415 missense probably damaging 0.98
R4667:Sipa1l2 UTSW 8 125453470 missense possibly damaging 0.93
R4687:Sipa1l2 UTSW 8 125491245 missense probably damaging 1.00
R4854:Sipa1l2 UTSW 8 125473601 missense probably damaging 1.00
R4890:Sipa1l2 UTSW 8 125491867 missense probably damaging 1.00
R5065:Sipa1l2 UTSW 8 125491585 missense probably benign 0.19
R5266:Sipa1l2 UTSW 8 125492126 missense probably damaging 0.99
R5475:Sipa1l2 UTSW 8 125491595 missense probably damaging 1.00
R5718:Sipa1l2 UTSW 8 125491248 missense probably damaging 1.00
R5910:Sipa1l2 UTSW 8 125491684 missense probably benign 0.42
R5916:Sipa1l2 UTSW 8 125468573 missense probably damaging 1.00
R5941:Sipa1l2 UTSW 8 125473536 missense probably damaging 0.99
R6083:Sipa1l2 UTSW 8 125468473 missense possibly damaging 0.87
R6185:Sipa1l2 UTSW 8 125468253 nonsense probably null
R6235:Sipa1l2 UTSW 8 125474871 missense probably damaging 1.00
R6274:Sipa1l2 UTSW 8 125469872 missense probably damaging 1.00
R6299:Sipa1l2 UTSW 8 125453464 missense possibly damaging 0.75
R6374:Sipa1l2 UTSW 8 125444630 missense probably damaging 1.00
R6459:Sipa1l2 UTSW 8 125444484 critical splice donor site probably null
R6462:Sipa1l2 UTSW 8 125491230 missense probably damaging 1.00
R6496:Sipa1l2 UTSW 8 125449894 missense probably benign 0.00
R6543:Sipa1l2 UTSW 8 125450362 missense possibly damaging 0.50
R7154:Sipa1l2 UTSW 8 125468339 missense probably benign 0.01
R7192:Sipa1l2 UTSW 8 125422609 missense probably benign 0.09
R7240:Sipa1l2 UTSW 8 125469860 missense probably damaging 1.00
R7361:Sipa1l2 UTSW 8 125453332 missense probably damaging 1.00
R7383:Sipa1l2 UTSW 8 125447646 missense probably damaging 1.00
R7417:Sipa1l2 UTSW 8 125482106 missense possibly damaging 0.93
R7604:Sipa1l2 UTSW 8 125419272 missense probably benign 0.45
R7658:Sipa1l2 UTSW 8 125492290 missense probably benign 0.00
R7743:Sipa1l2 UTSW 8 125464233 missense probably damaging 1.00
R7781:Sipa1l2 UTSW 8 125491827 missense possibly damaging 0.46
R7812:Sipa1l2 UTSW 8 125491595 missense probably damaging 1.00
R7829:Sipa1l2 UTSW 8 125451988 missense probably damaging 1.00
R7880:Sipa1l2 UTSW 8 125464393 missense probably damaging 1.00
R7884:Sipa1l2 UTSW 8 125447598 missense probably benign
R8057:Sipa1l2 UTSW 8 125468530 missense probably damaging 1.00
R8082:Sipa1l2 UTSW 8 125491809 missense possibly damaging 0.82
R8092:Sipa1l2 UTSW 8 125419168 missense probably benign 0.03
R8247:Sipa1l2 UTSW 8 125422633 missense probably benign 0.29
R8252:Sipa1l2 UTSW 8 125468671 missense probably damaging 1.00
R8386:Sipa1l2 UTSW 8 125492093 missense probably damaging 1.00
X0027:Sipa1l2 UTSW 8 125492136 missense probably damaging 1.00
Z1177:Sipa1l2 UTSW 8 125447556 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GAGTCTACACATCACTTCCTTCAGAG -3'
(R):5'- ACCGAACACTGTCCGATGAG -3'

Sequencing Primer
(F):5'- CACATCACTTCCTTCAGAGATAAAG -3'
(R):5'- ACACTGTCCGATGAGAGCGTG -3'
Posted On2016-07-06