Incidental Mutation 'R5194:Olfr814'
ID399984
Institutional Source Beutler Lab
Gene Symbol Olfr814
Ensembl Gene ENSMUSG00000059134
Gene Nameolfactory receptor 814
SynonymsMOR113-5, MOR113-8, GA_x6K02T2PULF-11553313-11552381
MMRRC Submission 042770-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5194 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129871473-129879851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 129874098 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 220 (V220I)
Ref Sequence ENSEMBL: ENSMUSP00000150458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081367] [ENSMUST00000213742] [ENSMUST00000216966]
Predicted Effect probably benign
Transcript: ENSMUST00000081367
AA Change: V220I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080106
Gene: ENSMUSG00000059134
AA Change: V220I

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5.2e-47 PFAM
Pfam:7tm_1 39 288 1.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213742
AA Change: V220I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000216966
AA Change: V220I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,250 N82D probably benign Het
Acadm C T 3: 153,933,118 R206H possibly damaging Het
Acly T A 11: 100,523,546 Y18F probably benign Het
Acnat2 G T 4: 49,380,452 Q291K probably benign Het
Agtpbp1 T C 13: 59,500,639 I456V probably benign Het
Ankrd7 A G 6: 18,868,077 N114S possibly damaging Het
Arfgef1 A T 1: 10,204,907 L307I probably benign Het
Arhgef2 A T 3: 88,635,649 I383F probably damaging Het
Cbs C T 17: 31,624,224 probably null Het
Cep135 T C 5: 76,615,777 V538A probably benign Het
D11Wsu47e T C 11: 113,688,828 S350P possibly damaging Het
Dennd5a T C 7: 109,933,729 E254G probably damaging Het
Drc7 T C 8: 95,061,717 V236A probably benign Het
Dtna C T 18: 23,590,245 Q169* probably null Het
Egfem1 G A 3: 29,357,196 probably null Het
Eif2ak3 T C 6: 70,858,478 S130P possibly damaging Het
Ewsr1 T C 11: 5,082,355 N297S unknown Het
F13a1 T G 13: 36,972,063 D192A probably damaging Het
Fam120a A G 13: 48,880,935 V1067A probably benign Het
Gm13124 A G 4: 144,555,082 V380A probably benign Het
Gm17490 T C 2: 11,626,251 Y5C unknown Het
Gm8587 C T 12: 88,089,786 noncoding transcript Het
H2-Ab1 C T 17: 34,269,378 probably benign Het
Hoxd12 T C 2: 74,675,103 L6P probably damaging Het
Ifi204 C T 1: 173,749,344 D564N possibly damaging Het
Irak2 T C 6: 113,690,790 V444A probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrba A C 3: 86,328,219 N877H probably damaging Het
Mylk3 T C 8: 85,352,866 I388V probably benign Het
Myo9b C T 8: 71,349,089 A1286V probably benign Het
Myt1l A C 12: 29,811,648 D143A unknown Het
Ngfr T C 11: 95,580,982 N63S probably benign Het
Olfr1264 T A 2: 90,021,526 Y180F probably damaging Het
Olfr1347 A G 7: 6,488,520 L118P probably damaging Het
Olfr576 A G 7: 102,965,864 I255V probably benign Het
Olfr698 A T 7: 106,753,219 H56Q probably benign Het
P2rx7 T C 5: 122,673,795 S390P probably benign Het
Pcdhga4 A C 18: 37,687,741 Q781P probably benign Het
Phip G A 9: 82,908,862 S677F probably benign Het
Ptpdc1 C A 13: 48,586,789 V389F possibly damaging Het
Rab2a T A 4: 8,604,381 I161N probably benign Het
Rnf113a2 T A 12: 84,417,337 M1K probably null Het
Schip1 T C 3: 68,494,872 V122A probably benign Het
Sdr16c5 C A 4: 4,006,663 A210S probably benign Het
Sh3bp1 A G 15: 78,903,101 K83E probably damaging Het
Sipa1l2 T C 8: 125,439,273 S1541G possibly damaging Het
Slc22a21 T C 11: 53,979,847 Y4C probably damaging Het
Smco1 C T 16: 32,273,774 H88Y probably damaging Het
Tll2 T C 19: 41,095,897 D697G probably damaging Het
Trim34a A G 7: 104,260,993 N334S possibly damaging Het
Ubqln1 A G 13: 58,199,033 I64T probably benign Het
Vstm2b T A 7: 40,902,488 probably null Het
Wdr17 A G 8: 54,687,604 F238L probably damaging Het
Wiz T C 17: 32,377,848 probably benign Het
Zfp407 T C 18: 84,561,309 S560G probably benign Het
Other mutations in Olfr814
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01831:Olfr814 APN 10 129874031 missense probably damaging 1.00
IGL02045:Olfr814 APN 10 129874222 missense probably benign 0.22
IGL02301:Olfr814 APN 10 129874079 missense probably damaging 0.99
R0277:Olfr814 UTSW 10 129874067 missense probably damaging 0.99
R0281:Olfr814 UTSW 10 129874546 missense possibly damaging 0.88
R0323:Olfr814 UTSW 10 129874067 missense probably damaging 0.99
R0394:Olfr814 UTSW 10 129873942 missense probably benign 0.29
R0546:Olfr814 UTSW 10 129874538 missense possibly damaging 0.94
R3813:Olfr814 UTSW 10 129873986 missense probably damaging 1.00
R4086:Olfr814 UTSW 10 129874298 missense possibly damaging 0.49
R4415:Olfr814 UTSW 10 129873957 missense probably benign 0.00
R4416:Olfr814 UTSW 10 129873957 missense probably benign 0.00
R4453:Olfr814 UTSW 10 129874661 missense probably null 0.30
R5306:Olfr814 UTSW 10 129873941 missense probably damaging 0.97
R5362:Olfr814 UTSW 10 129874553 missense probably damaging 1.00
R5609:Olfr814 UTSW 10 129874738 missense probably benign 0.01
R5987:Olfr814 UTSW 10 129874521 missense probably damaging 0.98
R6240:Olfr814 UTSW 10 129874677 missense probably benign
R6896:Olfr814 UTSW 10 129874754 start codon destroyed probably null 0.98
R7432:Olfr814 UTSW 10 129873850 missense probably benign
R7489:Olfr814 UTSW 10 129874682 missense probably damaging 1.00
R7652:Olfr814 UTSW 10 129874477 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTTGAGCACAGCTATTCCTTTG -3'
(R):5'- CATCAGCTTGTCCTGGGTTC -3'

Sequencing Primer
(F):5'- GAGCACAGCTATTCCTTTGCTCAAAG -3'
(R):5'- ACCACTGATTATTGGCCTTGATTTG -3'
Posted On2016-07-06