Incidental Mutation 'R5194:Ngfr'
ID399990
Institutional Source Beutler Lab
Gene Symbol Ngfr
Ensembl Gene ENSMUSG00000000120
Gene Namenerve growth factor receptor (TNFR superfamily, member 16)
Synonymsp75NGFR, p75NTR, p75, p75 neurotrophin receptor, LNGFR, Tnfrsf16
MMRRC Submission 042770-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.775) question?
Stock #R5194 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location95568818-95587735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95580982 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 63 (N63S)
Ref Sequence ENSEMBL: ENSMUSP00000000122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000122]
Predicted Effect probably benign
Transcript: ENSMUST00000000122
AA Change: N63S

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000000122
Gene: ENSMUSG00000000120
AA Change: N63S

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TNFR 35 67 1.51e-4 SMART
TNFR 70 110 1.54e-5 SMART
TNFR 112 149 1.79e-6 SMART
TNFR 152 191 2.84e-9 SMART
transmembrane domain 253 275 N/A INTRINSIC
DEATH 336 421 2.98e-21 SMART
Meta Mutation Damage Score 0.1041 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nerve growth factor receptor contains an extracellular domain containing four 40-amino acid repeats with 6 cysteine residues at conserved positions followed by a serine/threonine-rich region, a single transmembrane domain, and a 155-amino acid cytoplasmic domain. The cysteine-rich region contains the nerve growth factor binding domain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit increased perinatal lethality, skin abnormalities, growth retardation, reduced sensory nerve innervation, elevated pain threshold, ataxia, reduced sciatic nerve diameter, and blood vessel abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,250 N82D probably benign Het
Acadm C T 3: 153,933,118 R206H possibly damaging Het
Acly T A 11: 100,523,546 Y18F probably benign Het
Acnat2 G T 4: 49,380,452 Q291K probably benign Het
Agtpbp1 T C 13: 59,500,639 I456V probably benign Het
Ankrd7 A G 6: 18,868,077 N114S possibly damaging Het
Arfgef1 A T 1: 10,204,907 L307I probably benign Het
Arhgef2 A T 3: 88,635,649 I383F probably damaging Het
Cbs C T 17: 31,624,224 probably null Het
Cep135 T C 5: 76,615,777 V538A probably benign Het
D11Wsu47e T C 11: 113,688,828 S350P possibly damaging Het
Dennd5a T C 7: 109,933,729 E254G probably damaging Het
Drc7 T C 8: 95,061,717 V236A probably benign Het
Dtna C T 18: 23,590,245 Q169* probably null Het
Egfem1 G A 3: 29,357,196 probably null Het
Eif2ak3 T C 6: 70,858,478 S130P possibly damaging Het
Ewsr1 T C 11: 5,082,355 N297S unknown Het
F13a1 T G 13: 36,972,063 D192A probably damaging Het
Fam120a A G 13: 48,880,935 V1067A probably benign Het
Gm13124 A G 4: 144,555,082 V380A probably benign Het
Gm17490 T C 2: 11,626,251 Y5C unknown Het
Gm8587 C T 12: 88,089,786 noncoding transcript Het
H2-Ab1 C T 17: 34,269,378 probably benign Het
Hoxd12 T C 2: 74,675,103 L6P probably damaging Het
Ifi204 C T 1: 173,749,344 D564N possibly damaging Het
Irak2 T C 6: 113,690,790 V444A probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrba A C 3: 86,328,219 N877H probably damaging Het
Mylk3 T C 8: 85,352,866 I388V probably benign Het
Myo9b C T 8: 71,349,089 A1286V probably benign Het
Myt1l A C 12: 29,811,648 D143A unknown Het
Olfr1264 T A 2: 90,021,526 Y180F probably damaging Het
Olfr1347 A G 7: 6,488,520 L118P probably damaging Het
Olfr576 A G 7: 102,965,864 I255V probably benign Het
Olfr698 A T 7: 106,753,219 H56Q probably benign Het
Olfr814 C T 10: 129,874,098 V220I probably benign Het
P2rx7 T C 5: 122,673,795 S390P probably benign Het
Pcdhga4 A C 18: 37,687,741 Q781P probably benign Het
Phip G A 9: 82,908,862 S677F probably benign Het
Ptpdc1 C A 13: 48,586,789 V389F possibly damaging Het
Rab2a T A 4: 8,604,381 I161N probably benign Het
Rnf113a2 T A 12: 84,417,337 M1K probably null Het
Schip1 T C 3: 68,494,872 V122A probably benign Het
Sdr16c5 C A 4: 4,006,663 A210S probably benign Het
Sh3bp1 A G 15: 78,903,101 K83E probably damaging Het
Sipa1l2 T C 8: 125,439,273 S1541G possibly damaging Het
Slc22a21 T C 11: 53,979,847 Y4C probably damaging Het
Smco1 C T 16: 32,273,774 H88Y probably damaging Het
Tll2 T C 19: 41,095,897 D697G probably damaging Het
Trim34a A G 7: 104,260,993 N334S possibly damaging Het
Ubqln1 A G 13: 58,199,033 I64T probably benign Het
Vstm2b T A 7: 40,902,488 probably null Het
Wdr17 A G 8: 54,687,604 F238L probably damaging Het
Wiz T C 17: 32,377,848 probably benign Het
Zfp407 T C 18: 84,561,309 S560G probably benign Het
Other mutations in Ngfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02792:Ngfr APN 11 95571861 missense probably damaging 1.00
R0211:Ngfr UTSW 11 95571912 missense probably damaging 1.00
R0715:Ngfr UTSW 11 95574239 missense possibly damaging 0.62
R1668:Ngfr UTSW 11 95587545 missense probably damaging 1.00
R2298:Ngfr UTSW 11 95587490 small deletion probably benign
R6053:Ngfr UTSW 11 95571006 missense possibly damaging 0.57
R6109:Ngfr UTSW 11 95578057 missense probably damaging 1.00
R6190:Ngfr UTSW 11 95574441 missense probably benign 0.00
R7276:Ngfr UTSW 11 95574344 missense probably benign 0.12
R7366:Ngfr UTSW 11 95574429 missense possibly damaging 0.84
R7567:Ngfr UTSW 11 95574321 missense probably benign
RF014:Ngfr UTSW 11 95578201 missense probably damaging 1.00
RF041:Ngfr UTSW 11 95587511 small deletion probably benign
RF056:Ngfr UTSW 11 95587511 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TACCAGCCTCTCTGCTTGAG -3'
(R):5'- TTGGAAGACACCACCTTTGCTC -3'

Sequencing Primer
(F):5'- AGCATACTCCCTTATCCATTCAG -3'
(R):5'- TTGCTCCTGCCAGGCTGAC -3'
Posted On2016-07-06