Incidental Mutation 'R5194:Acly'
ID399992
Institutional Source Beutler Lab
Gene Symbol Acly
Ensembl Gene ENSMUSG00000020917
Gene NameATP citrate lyase
SynonymsA730098H14Rik
MMRRC Submission 042770-MU
Accession Numbers

NCBI RefSeq: NM_001199296.1, NM_134037.3; MGI: 103251

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5194 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100476353-100528000 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100523546 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 18 (Y18F)
Ref Sequence ENSEMBL: ENSMUSP00000127632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007131] [ENSMUST00000107385] [ENSMUST00000107389] [ENSMUST00000165111]
Predicted Effect probably benign
Transcript: ENSMUST00000007131
AA Change: Y18F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000007131
Gene: ENSMUSG00000020917
AA Change: Y18F

DomainStartEndE-ValueType
Pfam:ATP-grasp_2 6 207 2.4e-8 PFAM
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Pfam:CoA_binding 484 590 3.9e-14 PFAM
Pfam:Ligase_CoA 650 775 1.2e-16 PFAM
Pfam:Citrate_synt 868 1076 4.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107385
AA Change: Y18F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103008
Gene: ENSMUSG00000020917
AA Change: Y18F

DomainStartEndE-ValueType
Pfam:ATP-grasp_2 6 207 2.1e-6 PFAM
SCOP:d1eucb1 255 417 1e-26 SMART
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107389
AA Change: Y18F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103012
Gene: ENSMUSG00000020917
AA Change: Y18F

DomainStartEndE-ValueType
Pfam:Citrate_bind 244 421 1.7e-94 PFAM
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Pfam:CoA_binding 494 600 6.6e-15 PFAM
Pfam:Ligase_CoA 660 785 2.1e-16 PFAM
Pfam:Citrate_synt 879 1085 2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165111
AA Change: Y18F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127632
Gene: ENSMUSG00000020917
AA Change: Y18F

DomainStartEndE-ValueType
Pfam:ATP-grasp_2 6 207 2.4e-8 PFAM
low complexity region 441 457 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
Pfam:CoA_binding 484 590 3.9e-14 PFAM
Pfam:Ligase_CoA 650 775 1.2e-16 PFAM
Pfam:Citrate_synt 868 1076 4.8e-22 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype Strain: 5287022; 3036686
Lethality: E7-E8
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ATP citrate lyase is the primary enzyme responsible for the synthesis of cytosolic acetyl-CoA in many tissues. The enzyme is a tetramer (relative molecular weight approximately 440,000) of apparently identical subunits. It catalyzes the formation of acetyl-CoA and oxaloacetate from citrate and CoA with a concomitant hydrolysis of ATP to ADP and phosphate. The product, acetyl-CoA, serves several important biosynthetic pathways, including lipogenesis and cholesterogenesis. In nervous tissue, ATP citrate-lyase may be involved in the biosynthesis of acetylcholine. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mutation of this gene results in embryonic lethality. Heterozygous mutants display no obvious abnormalities. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI

All alleles(37) : Targeted(1) Gene trapped(35) Transgenic(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,250 N82D probably benign Het
Acadm C T 3: 153,933,118 R206H possibly damaging Het
Acnat2 G T 4: 49,380,452 Q291K probably benign Het
Agtpbp1 T C 13: 59,500,639 I456V probably benign Het
Ankrd7 A G 6: 18,868,077 N114S possibly damaging Het
Arfgef1 A T 1: 10,204,907 L307I probably benign Het
Arhgef2 A T 3: 88,635,649 I383F probably damaging Het
Cbs C T 17: 31,624,224 probably null Het
Cep135 T C 5: 76,615,777 V538A probably benign Het
D11Wsu47e T C 11: 113,688,828 S350P possibly damaging Het
Dennd5a T C 7: 109,933,729 E254G probably damaging Het
Drc7 T C 8: 95,061,717 V236A probably benign Het
Dtna C T 18: 23,590,245 Q169* probably null Het
Egfem1 G A 3: 29,357,196 probably null Het
Eif2ak3 T C 6: 70,858,478 S130P possibly damaging Het
Ewsr1 T C 11: 5,082,355 N297S unknown Het
F13a1 T G 13: 36,972,063 D192A probably damaging Het
Fam120a A G 13: 48,880,935 V1067A probably benign Het
Gm13124 A G 4: 144,555,082 V380A probably benign Het
Gm17490 T C 2: 11,626,251 Y5C unknown Het
Gm8587 C T 12: 88,089,786 noncoding transcript Het
H2-Ab1 C T 17: 34,269,378 probably benign Het
Hoxd12 T C 2: 74,675,103 L6P probably damaging Het
Ifi204 C T 1: 173,749,344 D564N possibly damaging Het
Irak2 T C 6: 113,690,790 V444A probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrba A C 3: 86,328,219 N877H probably damaging Het
Mylk3 T C 8: 85,352,866 I388V probably benign Het
Myo9b C T 8: 71,349,089 A1286V probably benign Het
Myt1l A C 12: 29,811,648 D143A unknown Het
Ngfr T C 11: 95,580,982 N63S probably benign Het
Olfr1264 T A 2: 90,021,526 Y180F probably damaging Het
Olfr1347 A G 7: 6,488,520 L118P probably damaging Het
Olfr576 A G 7: 102,965,864 I255V probably benign Het
Olfr698 A T 7: 106,753,219 H56Q probably benign Het
Olfr814 C T 10: 129,874,098 V220I probably benign Het
P2rx7 T C 5: 122,673,795 S390P probably benign Het
Pcdhga4 A C 18: 37,687,741 Q781P probably benign Het
Phip G A 9: 82,908,862 S677F probably benign Het
Ptpdc1 C A 13: 48,586,789 V389F possibly damaging Het
Rab2a T A 4: 8,604,381 I161N probably benign Het
Rnf113a2 T A 12: 84,417,337 M1K probably null Het
Schip1 T C 3: 68,494,872 V122A probably benign Het
Sdr16c5 C A 4: 4,006,663 A210S probably benign Het
Sh3bp1 A G 15: 78,903,101 K83E probably damaging Het
Sipa1l2 T C 8: 125,439,273 S1541G possibly damaging Het
Slc22a21 T C 11: 53,979,847 Y4C probably damaging Het
Smco1 C T 16: 32,273,774 H88Y probably damaging Het
Tll2 T C 19: 41,095,897 D697G probably damaging Het
Trim34a A G 7: 104,260,993 N334S possibly damaging Het
Ubqln1 A G 13: 58,199,033 I64T probably benign Het
Vstm2b T A 7: 40,902,488 probably null Het
Wdr17 A G 8: 54,687,604 F238L probably damaging Het
Wiz T C 17: 32,377,848 probably benign Het
Zfp407 T C 18: 84,561,309 S560G probably benign Het
Other mutations in Acly
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Acly APN 11 100495910 missense probably benign 0.00
IGL01661:Acly APN 11 100514342 splice site probably benign
IGL02349:Acly APN 11 100519679 missense probably benign 0.01
IGL02792:Acly APN 11 100478410 missense probably damaging 0.97
IGL03026:Acly APN 11 100519690 missense possibly damaging 0.94
IGL03144:Acly APN 11 100515083 missense possibly damaging 0.84
IGL03230:Acly APN 11 100494059 missense probably damaging 0.99
IGL03266:Acly APN 11 100483752 missense probably damaging 1.00
Coyote UTSW 11 100479255 missense probably damaging 0.99
lupine UTSW 11 100515905 missense probably damaging 1.00
P0014:Acly UTSW 11 100484604 missense probably benign 0.03
R0195:Acly UTSW 11 100512974 missense possibly damaging 0.56
R0319:Acly UTSW 11 100504982 missense probably damaging 1.00
R0598:Acly UTSW 11 100478390 missense probably damaging 1.00
R1115:Acly UTSW 11 100479255 missense probably damaging 0.99
R1201:Acly UTSW 11 100493935 missense probably damaging 1.00
R1498:Acly UTSW 11 100483801 missense probably benign 0.27
R1593:Acly UTSW 11 100481755 missense possibly damaging 0.74
R1804:Acly UTSW 11 100515905 missense probably damaging 1.00
R1817:Acly UTSW 11 100495891 missense probably benign 0.00
R1980:Acly UTSW 11 100495876 missense possibly damaging 0.87
R1997:Acly UTSW 11 100519151 missense probably damaging 1.00
R2125:Acly UTSW 11 100523496 missense probably benign 0.01
R3001:Acly UTSW 11 100504227 missense possibly damaging 0.91
R3002:Acly UTSW 11 100504227 missense possibly damaging 0.91
R3003:Acly UTSW 11 100504227 missense possibly damaging 0.91
R5509:Acly UTSW 11 100514979 missense probably damaging 0.97
R5594:Acly UTSW 11 100522120 splice site probably null
R6077:Acly UTSW 11 100519757 missense probably benign
R6310:Acly UTSW 11 100482220 missense possibly damaging 0.92
R7099:Acly UTSW 11 100492291 splice site probably null
R7148:Acly UTSW 11 100483782 missense possibly damaging 0.49
R7149:Acly UTSW 11 100484625 missense probably damaging 1.00
R7349:Acly UTSW 11 100521991 missense probably benign
R7450:Acly UTSW 11 100479275 missense probably damaging 1.00
R7484:Acly UTSW 11 100495963 missense probably damaging 1.00
R7687:Acly UTSW 11 100504854 critical splice donor site probably null
R7728:Acly UTSW 11 100516797 missense probably damaging 1.00
R7728:Acly UTSW 11 100519687 missense probably benign 0.06
R7750:Acly UTSW 11 100478013 critical splice donor site probably null
R8042:Acly UTSW 11 100514325 missense probably damaging 1.00
R8221:Acly UTSW 11 100519750 missense probably damaging 1.00
R8407:Acly UTSW 11 100494071 missense possibly damaging 0.67
R8677:Acly UTSW 11 100519743 missense probably damaging 0.96
R8721:Acly UTSW 11 100521980 critical splice donor site probably null
X0028:Acly UTSW 11 100495933 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGCTTTCCCCTCCTCAGAG -3'
(R):5'- TGTCAACGACGCTGCTTTG -3'

Sequencing Primer
(F):5'- GCCTGAGCTGGACAGAAG -3'
(R):5'- CTCTTGAGAAAAGCCAAGATCTAG -3'
Posted On2016-07-06