Incidental Mutation 'R5194:Myt1l'
ID399996
Institutional Source Beutler Lab
Gene Symbol Myt1l
Ensembl Gene ENSMUSG00000061911
Gene Namemyelin transcription factor 1-like
SynonymsC630034G21Rik, Nztf1, 2900046C06Rik, 2900093J19Rik, Png-1, Pmng1
MMRRC Submission 042770-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5194 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location29528384-29923213 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 29811648 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 143 (D143A)
Ref Sequence ENSEMBL: ENSMUSP00000151588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021009] [ENSMUST00000049784] [ENSMUST00000218583]
Predicted Effect unknown
Transcript: ENSMUST00000021009
AA Change: D143A
SMART Domains Protein: ENSMUSP00000021009
Gene: ENSMUSG00000061911
AA Change: D143A

DomainStartEndE-ValueType
Pfam:zf-C2HC 28 58 8.3e-19 PFAM
coiled coil region 148 182 N/A INTRINSIC
low complexity region 188 200 N/A INTRINSIC
low complexity region 222 233 N/A INTRINSIC
Pfam:zf-C2HC 502 532 1.1e-16 PFAM
Pfam:zf-C2HC 546 576 4e-18 PFAM
Pfam:MYT1 620 872 2.7e-135 PFAM
Pfam:zf-C2HC 901 931 8.4e-20 PFAM
Pfam:zf-C2HC 950 980 1.2e-18 PFAM
Pfam:zf-C2HC 1003 1033 1.1e-17 PFAM
coiled coil region 1055 1130 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000049784
AA Change: D143A
SMART Domains Protein: ENSMUSP00000058264
Gene: ENSMUSG00000061911
AA Change: D143A

DomainStartEndE-ValueType
Pfam:zf-C2HC 30 58 5.1e-18 PFAM
coiled coil region 148 182 N/A INTRINSIC
low complexity region 188 200 N/A INTRINSIC
low complexity region 222 233 N/A INTRINSIC
Pfam:zf-C2HC 506 533 9.9e-15 PFAM
Pfam:zf-C2HC 550 578 2.4e-16 PFAM
Pfam:MYT1 622 873 2.7e-122 PFAM
Pfam:zf-C2HC 905 933 6.3e-19 PFAM
Pfam:zf-C2HC 954 982 1.6e-18 PFAM
Pfam:zf-C2HC 1007 1035 1.4e-16 PFAM
coiled coil region 1057 1132 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000218583
AA Change: D143A
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the zinc finger superfamily of transcription factors. The encoded protein belongs to a novel class of cystein-cystein-histidine-cystein zinc finger proteins that function in the developing mammalian central nervous system. Forced expression of this gene in combination with the basic helix-loop-helix transcription factor NeuroD1 and the transcription factors POU class 3 homeobox 2 and achaete-scute family basic helix-loop-helix transcription factor 1 can convert fetal and postnatal human fibroblasts into induced neuronal cells, which are able to generate action potentials. Mutations in this gene have been associated with autosomal mental retardation-39 and autism spectrum disorder. Alternative splicing results in multiple variants. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,250 N82D probably benign Het
Acadm C T 3: 153,933,118 R206H possibly damaging Het
Acly T A 11: 100,523,546 Y18F probably benign Het
Acnat2 G T 4: 49,380,452 Q291K probably benign Het
Agtpbp1 T C 13: 59,500,639 I456V probably benign Het
Ankrd7 A G 6: 18,868,077 N114S possibly damaging Het
Arfgef1 A T 1: 10,204,907 L307I probably benign Het
Arhgef2 A T 3: 88,635,649 I383F probably damaging Het
Cbs C T 17: 31,624,224 probably null Het
Cep135 T C 5: 76,615,777 V538A probably benign Het
D11Wsu47e T C 11: 113,688,828 S350P possibly damaging Het
Dennd5a T C 7: 109,933,729 E254G probably damaging Het
Drc7 T C 8: 95,061,717 V236A probably benign Het
Dtna C T 18: 23,590,245 Q169* probably null Het
Egfem1 G A 3: 29,357,196 probably null Het
Eif2ak3 T C 6: 70,858,478 S130P possibly damaging Het
Ewsr1 T C 11: 5,082,355 N297S unknown Het
F13a1 T G 13: 36,972,063 D192A probably damaging Het
Fam120a A G 13: 48,880,935 V1067A probably benign Het
Gm13124 A G 4: 144,555,082 V380A probably benign Het
Gm17490 T C 2: 11,626,251 Y5C unknown Het
Gm8587 C T 12: 88,089,786 noncoding transcript Het
H2-Ab1 C T 17: 34,269,378 probably benign Het
Hoxd12 T C 2: 74,675,103 L6P probably damaging Het
Ifi204 C T 1: 173,749,344 D564N possibly damaging Het
Irak2 T C 6: 113,690,790 V444A probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrba A C 3: 86,328,219 N877H probably damaging Het
Mylk3 T C 8: 85,352,866 I388V probably benign Het
Myo9b C T 8: 71,349,089 A1286V probably benign Het
Ngfr T C 11: 95,580,982 N63S probably benign Het
Olfr1264 T A 2: 90,021,526 Y180F probably damaging Het
Olfr1347 A G 7: 6,488,520 L118P probably damaging Het
Olfr576 A G 7: 102,965,864 I255V probably benign Het
Olfr698 A T 7: 106,753,219 H56Q probably benign Het
Olfr814 C T 10: 129,874,098 V220I probably benign Het
P2rx7 T C 5: 122,673,795 S390P probably benign Het
Pcdhga4 A C 18: 37,687,741 Q781P probably benign Het
Phip G A 9: 82,908,862 S677F probably benign Het
Ptpdc1 C A 13: 48,586,789 V389F possibly damaging Het
Rab2a T A 4: 8,604,381 I161N probably benign Het
Rnf113a2 T A 12: 84,417,337 M1K probably null Het
Schip1 T C 3: 68,494,872 V122A probably benign Het
Sdr16c5 C A 4: 4,006,663 A210S probably benign Het
Sh3bp1 A G 15: 78,903,101 K83E probably damaging Het
Sipa1l2 T C 8: 125,439,273 S1541G possibly damaging Het
Slc22a21 T C 11: 53,979,847 Y4C probably damaging Het
Smco1 C T 16: 32,273,774 H88Y probably damaging Het
Tll2 T C 19: 41,095,897 D697G probably damaging Het
Trim34a A G 7: 104,260,993 N334S possibly damaging Het
Ubqln1 A G 13: 58,199,033 I64T probably benign Het
Vstm2b T A 7: 40,902,488 probably null Het
Wdr17 A G 8: 54,687,604 F238L probably damaging Het
Wiz T C 17: 32,377,848 probably benign Het
Zfp407 T C 18: 84,561,309 S560G probably benign Het
Other mutations in Myt1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Myt1l APN 12 29827424 missense unknown
IGL00896:Myt1l APN 12 29826886 missense unknown
IGL01653:Myt1l APN 12 29910771 missense unknown
IGL02632:Myt1l APN 12 29914293 missense unknown
IGL03088:Myt1l APN 12 29920477 missense probably benign 0.03
IGL03212:Myt1l APN 12 29827820 missense unknown
R0057:Myt1l UTSW 12 29842612 splice site probably null
R0126:Myt1l UTSW 12 29851720 missense possibly damaging 0.91
R0356:Myt1l UTSW 12 29811501 missense unknown
R0538:Myt1l UTSW 12 29842571 missense possibly damaging 0.47
R0587:Myt1l UTSW 12 29811635 missense unknown
R0629:Myt1l UTSW 12 29811485 missense unknown
R0709:Myt1l UTSW 12 29827733 missense unknown
R0736:Myt1l UTSW 12 29827814 missense unknown
R0920:Myt1l UTSW 12 29886139 missense unknown
R1618:Myt1l UTSW 12 29827397 missense unknown
R1660:Myt1l UTSW 12 29895273 missense unknown
R1716:Myt1l UTSW 12 29811538 missense unknown
R1758:Myt1l UTSW 12 29827242 missense unknown
R1852:Myt1l UTSW 12 29851661 missense probably benign 0.27
R1971:Myt1l UTSW 12 29827092 missense unknown
R2120:Myt1l UTSW 12 29783619 critical splice acceptor site probably null
R2227:Myt1l UTSW 12 29826970 missense unknown
R2865:Myt1l UTSW 12 29910789 missense probably benign 0.00
R4587:Myt1l UTSW 12 29910801 missense unknown
R4603:Myt1l UTSW 12 29842540 missense probably benign 0.01
R4659:Myt1l UTSW 12 29849457 missense probably damaging 0.98
R4734:Myt1l UTSW 12 29919926 missense possibly damaging 0.90
R4786:Myt1l UTSW 12 29811458 missense unknown
R4824:Myt1l UTSW 12 29849400 missense probably benign 0.02
R4835:Myt1l UTSW 12 29895305 missense unknown
R4888:Myt1l UTSW 12 29886139 missense unknown
R4976:Myt1l UTSW 12 29832303 missense unknown
R4980:Myt1l UTSW 12 29827039 missense unknown
R5119:Myt1l UTSW 12 29832303 missense unknown
R5247:Myt1l UTSW 12 29832332 missense unknown
R5249:Myt1l UTSW 12 29832332 missense unknown
R5427:Myt1l UTSW 12 29832332 missense unknown
R5428:Myt1l UTSW 12 29832332 missense unknown
R5429:Myt1l UTSW 12 29832332 missense unknown
R5431:Myt1l UTSW 12 29832332 missense unknown
R5628:Myt1l UTSW 12 29811621 missense unknown
R5926:Myt1l UTSW 12 29832332 missense unknown
R5959:Myt1l UTSW 12 29920040 critical splice donor site probably null
R6082:Myt1l UTSW 12 29832332 missense unknown
R6082:Myt1l UTSW 12 29842519 missense probably damaging 1.00
R6084:Myt1l UTSW 12 29832332 missense unknown
R6086:Myt1l UTSW 12 29832332 missense unknown
R6145:Myt1l UTSW 12 29832381 missense unknown
R6293:Myt1l UTSW 12 29827628 missense unknown
R6315:Myt1l UTSW 12 29827798 missense unknown
R6458:Myt1l UTSW 12 29895299 missense unknown
R6490:Myt1l UTSW 12 29832366 missense unknown
R6758:Myt1l UTSW 12 29842600 missense possibly damaging 0.94
R7230:Myt1l UTSW 12 29783874 missense probably damaging 0.99
R7330:Myt1l UTSW 12 29851554 missense unknown
R7545:Myt1l UTSW 12 29827088 missense unknown
R7662:Myt1l UTSW 12 29826869 missense unknown
R7744:Myt1l UTSW 12 29827549 missense unknown
U24488:Myt1l UTSW 12 29826896 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTCCCAAGCGAAAACCATTTG -3'
(R):5'- CTGGAATTGTTAGGATGCCACGG -3'

Sequencing Primer
(F):5'- GCAGATAGTTCCTCAGTAGACG -3'
(R):5'- TGTTAGGATGCCACGGATAATAACAC -3'
Posted On2016-07-06