Mutagenetix > Incidental Mutations

Incidental Mutation 'R5268:Ift140'

400003

Institutional Source

Beutler Lab

Gene Symbol

Ift140

Ensembl Gene

ENSMUSG00000024169

Gene Name

intraflagellar transport 140

Synonyms

Tce5, Wdtc2

MMRRC Submission

042860-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5268 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

25016091-25099495 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 25020627 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 86 (I86K)

Ref Sequence

ENSEMBL: ENSMUSP00000024983 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000024983
AA Change: I86K

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: I86K

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	8e-17	BLAST
Blast:WD40	510	547	6e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	9e-13	BLAST
Blast:TPR	1011	1044	1e-13	BLAST
Blast:TPR	1377	1410	8e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000137386
AA Change: I86K

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: I86K

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	1e-16	BLAST
Blast:WD40	510	547	5e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	8e-13	BLAST
Blast:TPR	1011	1044	9e-14	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151776

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810032O08Rik	G	T	11: 116,671,756	M18I	probably benign	Het
Adamtsl4	C	A	3: 95,680,163	R701L	probably damaging	Het
Adgrf5	T	C	17: 43,450,999	V1195A	probably damaging	Het
Agpat5	A	G	8: 18,881,862	T333A	possibly damaging	Het
Aspm	G	T	1: 139,464,295	G795C	probably damaging	Het
Car4	C	A	11: 84,965,800	Q305K	probably benign	Het
Catsperg1	T	C	7: 29,195,247	N612S	probably benign	Het
Cdc5l	G	A	17: 45,415,585	R354W	probably damaging	Het
Cdh9	G	A	15: 16,851,013	V623I	probably benign	Het
Cfap65	A	G	1: 74,924,902	V629A	probably benign	Het
Chd1	G	A	17: 15,735,743	V535I	probably damaging	Het
Col12a1	A	G	9: 79,678,047	V1316A	probably damaging	Het
Col6a3	A	T	1: 90,785,243	D1721E	unknown	Het
Cop1	T	A	1: 159,327,164	F647L	probably damaging	Het
Corin	A	C	5: 72,343,019	S421A	probably damaging	Het
Crb2	T	C	2: 37,790,821	V587A	probably damaging	Het
Ctc1	T	A	11: 69,029,810	V646E	possibly damaging	Het
Cyp2a12	A	T	7: 27,031,218	M203L	probably benign	Het
Dcdc2c	T	A	12: 28,516,657	K336M	possibly damaging	Het
Ddx39	G	A	8: 83,722,321	R275H	probably benign	Het
Des	A	G	1: 75,362,928	N310S	possibly damaging	Het
Dlk1	C	A	12: 109,459,838	S212R	probably benign	Het
Dnajc5b	A	G	3: 19,579,060	E149G	probably benign	Het
Dpep1	A	T	8: 123,194,089	I3F	probably benign	Het
Eml6	T	A	11: 29,803,108	R934S	probably benign	Het
Ercc6l2	T	C	13: 63,869,111	L676P	possibly damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Frem2	T	A	3: 53,653,154	I1311F	probably damaging	Het
Gldc	T	A	19: 30,145,725	M257L	probably damaging	Het
Gm5538	A	G	3: 59,752,023	E299G	probably damaging	Het
Gm8674	T	G	13: 49,901,354		noncoding transcript	Het
Gnai3	C	T	3: 108,123,541		probably null	Het
Gtf3a	A	G	5: 146,955,155	D300G	probably damaging	Het
Haus3	A	T	5: 34,166,105	V387D	probably damaging	Het
Hpf1	T	A	8: 60,893,734	F28I	possibly damaging	Het
Iars	A	G	13: 49,690,491	D147G	probably damaging	Het
Ibtk	A	T	9: 85,743,690	D2E	probably benign	Het
Igf2bp2	T	A	16: 22,079,491	I235F	probably damaging	Het
Ighv3-8	G	T	12: 114,322,632	A30E	probably benign	Het
Kcnq5	T	A	1: 21,505,725	T252S	probably damaging	Het
Lrrc4b	A	T	7: 44,461,363	N220Y	probably damaging	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Mamdc4	T	C	2: 25,564,690	T1037A	possibly damaging	Het
Mbd5	A	T	2: 49,272,094	I863F	possibly damaging	Het
Muc4	T	A	16: 32,751,666	S515T	possibly damaging	Het
Mylk4	T	A	13: 32,708,881		probably null	Het
Neu4	G	A	1: 94,024,947	R346H	probably benign	Het
Nxpe5	T	A	5: 138,239,938	Y253*	probably null	Het
Olfml2b	A	T	1: 170,649,761	E155V	probably damaging	Het
Olfr160	T	A	9: 37,712,004	I92F	probably damaging	Het
Olfr2	T	A	7: 107,000,904	N319Y	probably benign	Het
Olfr304	A	G	7: 86,385,659	*334Q	probably null	Het
Pamr1	G	A	2: 102,586,684	A114T	probably damaging	Het
Pdzd2	T	A	15: 12,592,177	N127I	probably damaging	Het
Pglyrp4	C	T	3: 90,726,964	L5F	probably damaging	Het
Plce1	T	A	19: 38,758,835	S1667T	possibly damaging	Het
Qser1	A	T	2: 104,787,431	V1012E	possibly damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rcn3	A	T	7: 45,086,779	D168E	probably damaging	Het
Rdh1	T	G	10: 127,759,963	V9G	possibly damaging	Het
Rin2	A	G	2: 145,844,760	T70A	probably benign	Het
Rnf207	T	C	4: 152,313,889	D276G	probably damaging	Het
Rtel1	C	T	2: 181,340,561	S368L	probably benign	Het
Slc15a5	C	A	6: 138,079,753	C55F	probably damaging	Het
Slc36a4	T	C	9: 15,726,916	F213L	possibly damaging	Het
Spata25	C	T	2: 164,828,034	G19D	probably damaging	Het
St5	A	G	7: 109,557,312	L77P	probably benign	Het
Tas2r102	A	T	6: 132,762,397	L89F	probably damaging	Het
Tbc1d1	A	G	5: 64,324,567	K704E	probably damaging	Het
Tert	T	G	13: 73,627,354	S75A	probably damaging	Het
Tiparp	T	A	3: 65,547,565	L195Q	possibly damaging	Het
Tmem205	A	C	9: 21,926,084	Y57*	probably null	Het
Tomm22	A	G	15: 79,671,227	R5G	probably benign	Het
Trav10	A	T	14: 53,506,058	S39C	probably benign	Het
Trav6-2	T	A	14: 52,667,748	N75K	probably benign	Het
Trio	T	C	15: 27,748,286	S2427G	probably benign	Het
Ttc41	C	A	10: 86,744,478	H763N	possibly damaging	Het
Usp29	A	T	7: 6,961,584	N142I	probably damaging	Het
Vmn1r204	G	T	13: 22,556,742	W181L	probably damaging	Het
Vmn2r76	G	A	7: 86,226,059	T570M	probably damaging	Het
Wdr90	A	G	17: 25,850,845	L1173P	probably damaging	Het
Wnt9a	T	A	11: 59,328,570	C141S	probably damaging	Het
Zfp462	A	T	4: 55,012,299	I1422L	probably benign	Het

Other mutations in Ift140

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Ift140	APN	17	25055644	missense	probably damaging	1.00
IGL00966:Ift140	APN	17	25018802	missense	probably damaging	1.00
IGL01082:Ift140	APN	17	25048455	missense	possibly damaging	0.89
IGL01394:Ift140	APN	17	25094702	missense	probably benign	0.02
IGL01816:Ift140	APN	17	25087025	splice site	probably null
IGL01994:Ift140	APN	17	25048443	missense	probably damaging	1.00
IGL02102:Ift140	APN	17	25033130	missense	probably benign	0.03
IGL02207:Ift140	APN	17	25055598	missense	probably benign
IGL02493:Ift140	APN	17	25087924	nonsense	probably null
IGL02735:Ift140	APN	17	25034035	splice site	probably benign
IGL02902:Ift140	APN	17	25090762	missense	probably damaging	1.00
IGL03037:Ift140	APN	17	25092394	missense	probably benign	0.02
IGL03122:Ift140	APN	17	25086910	missense	probably damaging	1.00
IGL03206:Ift140	APN	17	25092826	missense	probably damaging	0.98
IGL03271:Ift140	APN	17	25087906	missense	probably damaging	1.00
IGL03358:Ift140	APN	17	25087984	missense	probably damaging	1.00
PIT4515001:Ift140	UTSW	17	25086860	missense	probably damaging	0.98
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0197:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0355:Ift140	UTSW	17	25048435	nonsense	probably null
R0399:Ift140	UTSW	17	25050340	missense	possibly damaging	0.77
R0574:Ift140	UTSW	17	25051760	splice site	probably null
R0610:Ift140	UTSW	17	25035803	missense	probably benign	0.06
R0701:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0883:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0900:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R1167:Ift140	UTSW	17	25035745	missense	probably benign	0.01
R1295:Ift140	UTSW	17	25088933	critical splice donor site	probably null
R1588:Ift140	UTSW	17	25087985	missense	probably damaging	1.00
R1619:Ift140	UTSW	17	25088865	missense	probably damaging	1.00
R1637:Ift140	UTSW	17	25025634	missense	probably benign	0.40
R1854:Ift140	UTSW	17	25035839	missense	probably benign	0.05
R2397:Ift140	UTSW	17	25020736	missense	probably damaging	1.00
R2510:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R2918:Ift140	UTSW	17	25035831	missense	possibly damaging	0.66
R3433:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R3878:Ift140	UTSW	17	25028944	missense	probably benign	0.25
R4559:Ift140	UTSW	17	25090767	missense	probably damaging	0.97
R4670:Ift140	UTSW	17	25098961	unclassified	probably benign
R4711:Ift140	UTSW	17	25094717	unclassified	probably null
R4934:Ift140	UTSW	17	25048488	missense	probably benign
R4949:Ift140	UTSW	17	25094665	missense	probably benign	0.06
R4982:Ift140	UTSW	17	25036994	missense	probably damaging	0.99
R5099:Ift140	UTSW	17	25090700	missense	probably damaging	1.00
R5223:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R5423:Ift140	UTSW	17	25033085	missense	probably damaging	0.96
R5480:Ift140	UTSW	17	25020576	missense	probably damaging	1.00
R5655:Ift140	UTSW	17	25045064	missense	probably damaging	1.00
R5756:Ift140	UTSW	17	25028813	missense	possibly damaging	0.62
R5837:Ift140	UTSW	17	25089540	missense	probably damaging	1.00
R5894:Ift140	UTSW	17	25033919	missense	possibly damaging	0.92
R5907:Ift140	UTSW	17	25092371	missense	probably benign	0.02
R5966:Ift140	UTSW	17	25094761	nonsense	probably null
R6000:Ift140	UTSW	17	25036960	missense	probably benign	0.00
R6046:Ift140	UTSW	17	25055589	missense	probably benign	0.00
R6050:Ift140	UTSW	17	25091005	missense	probably damaging	1.00
R6103:Ift140	UTSW	17	25093126	missense	probably damaging	1.00
R6239:Ift140	UTSW	17	25028972	missense	probably benign	0.26
R6287:Ift140	UTSW	17	25050434	missense	probably benign
R6539:Ift140	UTSW	17	25094669	missense	possibly damaging	0.87
R6656:Ift140	UTSW	17	25032173	missense	probably damaging	0.96
R6723:Ift140	UTSW	17	25033116	missense	probably benign	0.08
R6749:Ift140	UTSW	17	25098916	missense	probably damaging	0.99
R6892:Ift140	UTSW	17	25020546	missense	possibly damaging	0.95
R7151:Ift140	UTSW	17	25055725	missense	probably damaging	1.00
R7235:Ift140	UTSW	17	25020645	missense	possibly damaging	0.88
R7424:Ift140	UTSW	17	25037036	missense	possibly damaging	0.81
R7552:Ift140	UTSW	17	25033115	missense	probably benign	0.02
R7560:Ift140	UTSW	17	25092341	missense	probably benign	0.28
R7660:Ift140	UTSW	17	25051824	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGACCGCTTCTTGATGTACC -3'
(R):5'- ATACCTGACGAGAGCAGCTG -3'

Sequencing Primer
(F):5'- ATGTACCTACTCCTATCTACAATGGG -3'
(R):5'- TGACGAGAGCAGCTGAACCTTAC -3'

Posted On

2016-07-06