Incidental Mutation 'R5268:Wdr90'
ID400005
Institutional Source Beutler Lab
Gene Symbol Wdr90
Ensembl Gene ENSMUSG00000073434
Gene NameWD repeat domain 90
Synonyms3230401M21Rik
MMRRC Submission 042860-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R5268 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25844771-25861501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25850845 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1173 (L1173P)
Ref Sequence ENSEMBL: ENSMUSP00000078426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079461] [ENSMUST00000176923]
Predicted Effect probably damaging
Transcript: ENSMUST00000079461
AA Change: L1173P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078426
Gene: ENSMUSG00000073434
AA Change: L1173P

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 183 5e-26 PFAM
Pfam:DUF667 210 271 3.7e-9 PFAM
low complexity region 381 396 N/A INTRINSIC
WD40 478 519 5.94e0 SMART
WD40 522 565 3.2e0 SMART
WD40 572 612 3.3e1 SMART
WD40 687 725 1.15e1 SMART
WD40 728 766 5.75e-1 SMART
WD40 768 808 9.24e-4 SMART
WD40 811 850 4.13e0 SMART
WD40 853 892 4.62e-1 SMART
WD40 950 993 1.07e1 SMART
WD40 996 1035 5.75e-1 SMART
WD40 1040 1077 1.58e-2 SMART
WD40 1290 1334 5.23e-3 SMART
WD40 1337 1378 1.27e-1 SMART
WD40 1384 1419 1.83e2 SMART
WD40 1422 1469 3.08e0 SMART
WD40 1472 1509 9.9e0 SMART
WD40 1568 1607 9.02e-7 SMART
WD40 1610 1655 5.75e-1 SMART
WD40 1659 1697 2.98e-1 SMART
WD40 1700 1749 6.14e1 SMART
WD40 1850 1888 1.92e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176575
Predicted Effect probably benign
Transcript: ENSMUST00000176678
Predicted Effect possibly damaging
Transcript: ENSMUST00000176923
AA Change: L1155P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135420
Gene: ENSMUSG00000073434
AA Change: L1155P

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 252 5.1e-14 PFAM
low complexity region 363 378 N/A INTRINSIC
WD40 460 501 5.94e0 SMART
WD40 504 547 3.2e0 SMART
WD40 554 594 3.3e1 SMART
WD40 669 707 1.15e1 SMART
WD40 710 748 5.75e-1 SMART
WD40 750 790 9.24e-4 SMART
WD40 793 832 4.13e0 SMART
WD40 835 874 4.62e-1 SMART
WD40 932 975 1.07e1 SMART
WD40 978 1017 5.75e-1 SMART
WD40 1022 1059 1.58e-2 SMART
WD40 1272 1316 5.23e-3 SMART
WD40 1319 1360 1.27e-1 SMART
WD40 1366 1401 1.83e2 SMART
WD40 1404 1451 3.08e0 SMART
WD40 1454 1491 9.9e0 SMART
WD40 1550 1589 9.02e-7 SMART
WD40 1592 1637 5.75e-1 SMART
WD40 1641 1679 2.98e-1 SMART
WD40 1682 1731 6.14e1 SMART
WD40 1832 1870 1.92e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810032O08Rik G T 11: 116,671,756 M18I probably benign Het
Adamtsl4 C A 3: 95,680,163 R701L probably damaging Het
Adgrf5 T C 17: 43,450,999 V1195A probably damaging Het
Agpat5 A G 8: 18,881,862 T333A possibly damaging Het
Aspm G T 1: 139,464,295 G795C probably damaging Het
Car4 C A 11: 84,965,800 Q305K probably benign Het
Catsperg1 T C 7: 29,195,247 N612S probably benign Het
Cdc5l G A 17: 45,415,585 R354W probably damaging Het
Cdh9 G A 15: 16,851,013 V623I probably benign Het
Cfap65 A G 1: 74,924,902 V629A probably benign Het
Chd1 G A 17: 15,735,743 V535I probably damaging Het
Col12a1 A G 9: 79,678,047 V1316A probably damaging Het
Col6a3 A T 1: 90,785,243 D1721E unknown Het
Cop1 T A 1: 159,327,164 F647L probably damaging Het
Corin A C 5: 72,343,019 S421A probably damaging Het
Crb2 T C 2: 37,790,821 V587A probably damaging Het
Ctc1 T A 11: 69,029,810 V646E possibly damaging Het
Cyp2a12 A T 7: 27,031,218 M203L probably benign Het
Dcdc2c T A 12: 28,516,657 K336M possibly damaging Het
Ddx39 G A 8: 83,722,321 R275H probably benign Het
Des A G 1: 75,362,928 N310S possibly damaging Het
Dlk1 C A 12: 109,459,838 S212R probably benign Het
Dnajc5b A G 3: 19,579,060 E149G probably benign Het
Dpep1 A T 8: 123,194,089 I3F probably benign Het
Eml6 T A 11: 29,803,108 R934S probably benign Het
Ercc6l2 T C 13: 63,869,111 L676P possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Frem2 T A 3: 53,653,154 I1311F probably damaging Het
Gldc T A 19: 30,145,725 M257L probably damaging Het
Gm5538 A G 3: 59,752,023 E299G probably damaging Het
Gm8674 T G 13: 49,901,354 noncoding transcript Het
Gnai3 C T 3: 108,123,541 probably null Het
Gtf3a A G 5: 146,955,155 D300G probably damaging Het
Haus3 A T 5: 34,166,105 V387D probably damaging Het
Hpf1 T A 8: 60,893,734 F28I possibly damaging Het
Iars A G 13: 49,690,491 D147G probably damaging Het
Ibtk A T 9: 85,743,690 D2E probably benign Het
Ift140 T A 17: 25,020,627 I86K possibly damaging Het
Igf2bp2 T A 16: 22,079,491 I235F probably damaging Het
Ighv3-8 G T 12: 114,322,632 A30E probably benign Het
Kcnq5 T A 1: 21,505,725 T252S probably damaging Het
Lrrc4b A T 7: 44,461,363 N220Y probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mamdc4 T C 2: 25,564,690 T1037A possibly damaging Het
Mbd5 A T 2: 49,272,094 I863F possibly damaging Het
Muc4 T A 16: 32,751,666 S515T possibly damaging Het
Mylk4 T A 13: 32,708,881 probably null Het
Neu4 G A 1: 94,024,947 R346H probably benign Het
Nxpe5 T A 5: 138,239,938 Y253* probably null Het
Olfml2b A T 1: 170,649,761 E155V probably damaging Het
Olfr160 T A 9: 37,712,004 I92F probably damaging Het
Olfr2 T A 7: 107,000,904 N319Y probably benign Het
Olfr304 A G 7: 86,385,659 *334Q probably null Het
Pamr1 G A 2: 102,586,684 A114T probably damaging Het
Pdzd2 T A 15: 12,592,177 N127I probably damaging Het
Pglyrp4 C T 3: 90,726,964 L5F probably damaging Het
Plce1 T A 19: 38,758,835 S1667T possibly damaging Het
Qser1 A T 2: 104,787,431 V1012E possibly damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rcn3 A T 7: 45,086,779 D168E probably damaging Het
Rdh1 T G 10: 127,759,963 V9G possibly damaging Het
Rin2 A G 2: 145,844,760 T70A probably benign Het
Rnf207 T C 4: 152,313,889 D276G probably damaging Het
Rtel1 C T 2: 181,340,561 S368L probably benign Het
Slc15a5 C A 6: 138,079,753 C55F probably damaging Het
Slc36a4 T C 9: 15,726,916 F213L possibly damaging Het
Spata25 C T 2: 164,828,034 G19D probably damaging Het
St5 A G 7: 109,557,312 L77P probably benign Het
Tas2r102 A T 6: 132,762,397 L89F probably damaging Het
Tbc1d1 A G 5: 64,324,567 K704E probably damaging Het
Tert T G 13: 73,627,354 S75A probably damaging Het
Tiparp T A 3: 65,547,565 L195Q possibly damaging Het
Tmem205 A C 9: 21,926,084 Y57* probably null Het
Tomm22 A G 15: 79,671,227 R5G probably benign Het
Trav10 A T 14: 53,506,058 S39C probably benign Het
Trav6-2 T A 14: 52,667,748 N75K probably benign Het
Trio T C 15: 27,748,286 S2427G probably benign Het
Ttc41 C A 10: 86,744,478 H763N possibly damaging Het
Usp29 A T 7: 6,961,584 N142I probably damaging Het
Vmn1r204 G T 13: 22,556,742 W181L probably damaging Het
Vmn2r76 G A 7: 86,226,059 T570M probably damaging Het
Wnt9a T A 11: 59,328,570 C141S probably damaging Het
Zfp462 A T 4: 55,012,299 I1422L probably benign Het
Other mutations in Wdr90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Wdr90 APN 17 25849364 missense probably damaging 1.00
IGL01118:Wdr90 APN 17 25854687 missense probably damaging 1.00
IGL01964:Wdr90 APN 17 25848409 missense probably benign
IGL02116:Wdr90 APN 17 25859492 missense probably benign 0.12
IGL02172:Wdr90 APN 17 25850434 missense probably benign 0.22
IGL02716:Wdr90 APN 17 25857220 missense probably damaging 0.96
IGL02961:Wdr90 APN 17 25848675 nonsense probably null
IGL03229:Wdr90 APN 17 25845463 splice site probably benign
IGL03367:Wdr90 APN 17 25847791 splice site probably benign
IGL03098:Wdr90 UTSW 17 25859987 intron probably benign
R0111:Wdr90 UTSW 17 25848444 splice site probably benign
R0454:Wdr90 UTSW 17 25860049 missense probably damaging 0.96
R0457:Wdr90 UTSW 17 25860485 missense probably benign 0.00
R0488:Wdr90 UTSW 17 25848617 missense probably damaging 1.00
R0622:Wdr90 UTSW 17 25855658 missense probably damaging 1.00
R0671:Wdr90 UTSW 17 25846393 missense probably benign 0.04
R0799:Wdr90 UTSW 17 25860130 missense probably benign 0.38
R1177:Wdr90 UTSW 17 25846054 missense possibly damaging 0.85
R1460:Wdr90 UTSW 17 25860448 missense possibly damaging 0.82
R1468:Wdr90 UTSW 17 25854053 missense probably damaging 1.00
R1468:Wdr90 UTSW 17 25854053 missense probably damaging 1.00
R1544:Wdr90 UTSW 17 25849310 missense possibly damaging 0.69
R2057:Wdr90 UTSW 17 25855199 missense probably benign 0.05
R2087:Wdr90 UTSW 17 25846603 missense probably damaging 1.00
R2159:Wdr90 UTSW 17 25851741 missense probably benign
R2208:Wdr90 UTSW 17 25860388 missense probably damaging 1.00
R2345:Wdr90 UTSW 17 25859162 missense probably benign 0.05
R2391:Wdr90 UTSW 17 25851455 missense probably damaging 1.00
R2394:Wdr90 UTSW 17 25851455 missense probably damaging 1.00
R2520:Wdr90 UTSW 17 25855352 missense probably damaging 1.00
R3798:Wdr90 UTSW 17 25850498 missense probably benign 0.01
R3979:Wdr90 UTSW 17 25859278 missense probably benign 0.00
R4111:Wdr90 UTSW 17 25849368 missense possibly damaging 0.94
R4326:Wdr90 UTSW 17 25853731 missense probably benign 0.25
R4459:Wdr90 UTSW 17 25861002 missense possibly damaging 0.95
R4697:Wdr90 UTSW 17 25855363 missense probably benign 0.03
R4735:Wdr90 UTSW 17 25859450 missense probably benign
R4907:Wdr90 UTSW 17 25860650 intron probably benign
R5070:Wdr90 UTSW 17 25846333 missense probably damaging 1.00
R5230:Wdr90 UTSW 17 25855303 missense probably benign 0.01
R5287:Wdr90 UTSW 17 25861467 utr 5 prime probably benign
R5382:Wdr90 UTSW 17 25845598 missense probably damaging 1.00
R5511:Wdr90 UTSW 17 25845021 unclassified probably benign
R5545:Wdr90 UTSW 17 25845856 missense probably damaging 1.00
R5707:Wdr90 UTSW 17 25857192 missense probably benign 0.00
R5973:Wdr90 UTSW 17 25845133 missense probably damaging 0.99
R5973:Wdr90 UTSW 17 25846407 missense probably damaging 1.00
R6385:Wdr90 UTSW 17 25848530 missense probably damaging 1.00
R6481:Wdr90 UTSW 17 25845911 missense probably damaging 0.99
R7078:Wdr90 UTSW 17 25849649 missense probably damaging 1.00
R7214:Wdr90 UTSW 17 25845393 missense probably benign 0.00
R7288:Wdr90 UTSW 17 25846312 missense probably benign 0.03
R7304:Wdr90 UTSW 17 25851506 missense probably benign 0.10
R7309:Wdr90 UTSW 17 25860702 missense probably benign 0.02
R7391:Wdr90 UTSW 17 25846528 missense probably benign 0.08
R7622:Wdr90 UTSW 17 25854109 missense probably benign 0.00
R7646:Wdr90 UTSW 17 25860130 missense probably benign 0.38
R7772:Wdr90 UTSW 17 25861491 start gained probably benign
R7779:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7780:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7781:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7782:Wdr90 UTSW 17 25846326 missense probably damaging 1.00
R7812:Wdr90 UTSW 17 25852558 missense probably damaging 1.00
R7870:Wdr90 UTSW 17 25860539 missense probably damaging 0.96
R7911:Wdr90 UTSW 17 25850749 missense probably benign 0.00
R8126:Wdr90 UTSW 17 25848977 missense possibly damaging 0.48
R8260:Wdr90 UTSW 17 25845167 missense probably damaging 1.00
R8315:Wdr90 UTSW 17 25845425 missense probably benign 0.21
X0064:Wdr90 UTSW 17 25848563 missense probably damaging 1.00
Z1176:Wdr90 UTSW 17 25860496 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCAGGAAAGATTACTACAAGCCCC -3'
(R):5'- TAATGGTCCGGTCAGTGAGC -3'

Sequencing Primer
(F):5'- CCCAAAGTGGCCTGACAGAG -3'
(R):5'- ACTTTCAAGACAGCTCTGGC -3'
Posted On2016-07-06