Incidental Mutation 'R5194:Ubqln1'
ID400008
Institutional Source Beutler Lab
Gene Symbol Ubqln1
Ensembl Gene ENSMUSG00000005312
Gene Nameubiquilin 1
SynonymsXDRP1, Plic-1, Dsk2, DA41, D13Ertd372e, 1110046H03Rik, 1810030E05Rik
MMRRC Submission 042770-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.671) question?
Stock #R5194 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location58176156-58215653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58199033 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 64 (I64T)
Ref Sequence ENSEMBL: ENSMUSP00000075782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058735] [ENSMUST00000076454]
Predicted Effect probably benign
Transcript: ENSMUST00000058735
AA Change: I64T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050191
Gene: ENSMUSG00000005312
AA Change: I64T

DomainStartEndE-ValueType
UBQ 28 98 7.78e-16 SMART
low complexity region 136 154 N/A INTRINSIC
STI1 173 201 6e0 SMART
STI1 203 242 6.75e-10 SMART
low complexity region 316 356 N/A INTRINSIC
STI1 381 428 2.62e-7 SMART
STI1 432 464 3.1e0 SMART
low complexity region 483 499 N/A INTRINSIC
UBA 540 578 1.77e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076454
AA Change: I64T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075782
Gene: ENSMUSG00000005312
AA Change: I64T

DomainStartEndE-ValueType
UBQ 28 98 7.78e-16 SMART
low complexity region 136 154 N/A INTRINSIC
STI1 173 201 6e0 SMART
STI1 203 242 6.75e-10 SMART
low complexity region 316 356 N/A INTRINSIC
STI1 381 420 2.24e-6 SMART
low complexity region 455 471 N/A INTRINSIC
UBA 512 550 1.77e-6 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and thus are thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This ubiquilin has also been shown to modulate accumulation of presenilin proteins, and it is found in lesions associated with Alzheimer's and Parkinson's disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null animals display impaired degradation of ubiquitinated proteins in the brain, increased ischemia/reperfusion-caused brain injury, and slower functional recovery after injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,250 N82D probably benign Het
Acadm C T 3: 153,933,118 R206H possibly damaging Het
Acly T A 11: 100,523,546 Y18F probably benign Het
Acnat2 G T 4: 49,380,452 Q291K probably benign Het
Agtpbp1 T C 13: 59,500,639 I456V probably benign Het
Ankrd7 A G 6: 18,868,077 N114S possibly damaging Het
Arfgef1 A T 1: 10,204,907 L307I probably benign Het
Arhgef2 A T 3: 88,635,649 I383F probably damaging Het
Cbs C T 17: 31,624,224 probably null Het
Cep135 T C 5: 76,615,777 V538A probably benign Het
D11Wsu47e T C 11: 113,688,828 S350P possibly damaging Het
Dennd5a T C 7: 109,933,729 E254G probably damaging Het
Drc7 T C 8: 95,061,717 V236A probably benign Het
Dtna C T 18: 23,590,245 Q169* probably null Het
Egfem1 G A 3: 29,357,196 probably null Het
Eif2ak3 T C 6: 70,858,478 S130P possibly damaging Het
Ewsr1 T C 11: 5,082,355 N297S unknown Het
F13a1 T G 13: 36,972,063 D192A probably damaging Het
Fam120a A G 13: 48,880,935 V1067A probably benign Het
Gm13124 A G 4: 144,555,082 V380A probably benign Het
Gm17490 T C 2: 11,626,251 Y5C unknown Het
Gm8587 C T 12: 88,089,786 noncoding transcript Het
H2-Ab1 C T 17: 34,269,378 probably benign Het
Hoxd12 T C 2: 74,675,103 L6P probably damaging Het
Ifi204 C T 1: 173,749,344 D564N possibly damaging Het
Irak2 T C 6: 113,690,790 V444A probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrba A C 3: 86,328,219 N877H probably damaging Het
Mylk3 T C 8: 85,352,866 I388V probably benign Het
Myo9b C T 8: 71,349,089 A1286V probably benign Het
Myt1l A C 12: 29,811,648 D143A unknown Het
Ngfr T C 11: 95,580,982 N63S probably benign Het
Olfr1264 T A 2: 90,021,526 Y180F probably damaging Het
Olfr1347 A G 7: 6,488,520 L118P probably damaging Het
Olfr576 A G 7: 102,965,864 I255V probably benign Het
Olfr698 A T 7: 106,753,219 H56Q probably benign Het
Olfr814 C T 10: 129,874,098 V220I probably benign Het
P2rx7 T C 5: 122,673,795 S390P probably benign Het
Pcdhga4 A C 18: 37,687,741 Q781P probably benign Het
Phip G A 9: 82,908,862 S677F probably benign Het
Ptpdc1 C A 13: 48,586,789 V389F possibly damaging Het
Rab2a T A 4: 8,604,381 I161N probably benign Het
Rnf113a2 T A 12: 84,417,337 M1K probably null Het
Schip1 T C 3: 68,494,872 V122A probably benign Het
Sdr16c5 C A 4: 4,006,663 A210S probably benign Het
Sh3bp1 A G 15: 78,903,101 K83E probably damaging Het
Sipa1l2 T C 8: 125,439,273 S1541G possibly damaging Het
Slc22a21 T C 11: 53,979,847 Y4C probably damaging Het
Smco1 C T 16: 32,273,774 H88Y probably damaging Het
Tll2 T C 19: 41,095,897 D697G probably damaging Het
Trim34a A G 7: 104,260,993 N334S possibly damaging Het
Vstm2b T A 7: 40,902,488 probably null Het
Wdr17 A G 8: 54,687,604 F238L probably damaging Het
Wiz T C 17: 32,377,848 probably benign Het
Zfp407 T C 18: 84,561,309 S560G probably benign Het
Other mutations in Ubqln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Ubqln1 APN 13 58177992 nonsense probably null
IGL01566:Ubqln1 APN 13 58179667 splice site probably null
IGL02160:Ubqln1 APN 13 58192137 missense probably damaging 1.00
IGL03171:Ubqln1 APN 13 58180858 missense probably damaging 1.00
R0140:Ubqln1 UTSW 13 58193289 missense probably damaging 1.00
R1676:Ubqln1 UTSW 13 58179391 missense possibly damaging 0.67
R1712:Ubqln1 UTSW 13 58192081 missense probably damaging 1.00
R4400:Ubqln1 UTSW 13 58193388 missense probably damaging 1.00
R5419:Ubqln1 UTSW 13 58183183 missense probably damaging 0.99
R5778:Ubqln1 UTSW 13 58183317 missense probably benign 0.00
R6198:Ubqln1 UTSW 13 58196590 missense probably benign
R7829:Ubqln1 UTSW 13 58177905 missense probably damaging 1.00
R8479:Ubqln1 UTSW 13 58191839 missense probably benign
R8523:Ubqln1 UTSW 13 58191755 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCATGGAGTCACAATGTTG -3'
(R):5'- GAGTCCTTCCTGTTAGAGACG -3'

Sequencing Primer
(F):5'- GGAGTCACAATGTTGTTTTTCACC -3'
(R):5'- ACGGGATGGTTGGTTGCAC -3'
Posted On2016-07-06