Incidental Mutation 'R5194:Sh3bp1'
ID400019
Institutional Source Beutler Lab
Gene Symbol Sh3bp1
Ensembl Gene ENSMUSG00000022436
Gene NameSH3-domain binding protein 1
Synonyms3BP-1
MMRRC Submission 042770-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R5194 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location78899768-78912051 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78903101 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 83 (K83E)
Ref Sequence ENSEMBL: ENSMUSP00000154996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001226] [ENSMUST00000061239] [ENSMUST00000109698] [ENSMUST00000132047] [ENSMUST00000134703] [ENSMUST00000148893] [ENSMUST00000151146]
Predicted Effect probably damaging
Transcript: ENSMUST00000001226
AA Change: K147E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001226
Gene: ENSMUSG00000022436
AA Change: K147E

DomainStartEndE-ValueType
Pfam:BAR 2 254 7e-37 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
low complexity region 558 593 N/A INTRINSIC
low complexity region 604 633 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000061239
AA Change: K147E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052181
Gene: ENSMUSG00000022436
AA Change: K147E

DomainStartEndE-ValueType
Pfam:BAR 2 254 2.2e-36 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109698
AA Change: K147E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105320
Gene: ENSMUSG00000022436
AA Change: K147E

DomainStartEndE-ValueType
Pfam:BAR 2 254 2.2e-36 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132047
AA Change: K147E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138598
Gene: ENSMUSG00000022436
AA Change: K147E

DomainStartEndE-ValueType
Pfam:BAR 2 254 5.4e-36 PFAM
RhoGAP 287 466 2.04e-63 SMART
low complexity region 500 518 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134703
AA Change: K83E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000148893
SMART Domains Protein: ENSMUSP00000117839
Gene: ENSMUSG00000022436

DomainStartEndE-ValueType
Blast:BAR 2 55 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000151146
SMART Domains Protein: ENSMUSP00000138780
Gene: ENSMUSG00000022436

DomainStartEndE-ValueType
Pfam:BAR 2 143 9e-22 PFAM
low complexity region 160 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231057
Meta Mutation Damage Score 0.1894 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,250 N82D probably benign Het
Acadm C T 3: 153,933,118 R206H possibly damaging Het
Acly T A 11: 100,523,546 Y18F probably benign Het
Acnat2 G T 4: 49,380,452 Q291K probably benign Het
Agtpbp1 T C 13: 59,500,639 I456V probably benign Het
Ankrd7 A G 6: 18,868,077 N114S possibly damaging Het
Arfgef1 A T 1: 10,204,907 L307I probably benign Het
Arhgef2 A T 3: 88,635,649 I383F probably damaging Het
Cbs C T 17: 31,624,224 probably null Het
Cep135 T C 5: 76,615,777 V538A probably benign Het
D11Wsu47e T C 11: 113,688,828 S350P possibly damaging Het
Dennd5a T C 7: 109,933,729 E254G probably damaging Het
Drc7 T C 8: 95,061,717 V236A probably benign Het
Dtna C T 18: 23,590,245 Q169* probably null Het
Egfem1 G A 3: 29,357,196 probably null Het
Eif2ak3 T C 6: 70,858,478 S130P possibly damaging Het
Ewsr1 T C 11: 5,082,355 N297S unknown Het
F13a1 T G 13: 36,972,063 D192A probably damaging Het
Fam120a A G 13: 48,880,935 V1067A probably benign Het
Gm13124 A G 4: 144,555,082 V380A probably benign Het
Gm17490 T C 2: 11,626,251 Y5C unknown Het
Gm8587 C T 12: 88,089,786 noncoding transcript Het
H2-Ab1 C T 17: 34,269,378 probably benign Het
Hoxd12 T C 2: 74,675,103 L6P probably damaging Het
Ifi204 C T 1: 173,749,344 D564N possibly damaging Het
Irak2 T C 6: 113,690,790 V444A probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrba A C 3: 86,328,219 N877H probably damaging Het
Mylk3 T C 8: 85,352,866 I388V probably benign Het
Myo9b C T 8: 71,349,089 A1286V probably benign Het
Myt1l A C 12: 29,811,648 D143A unknown Het
Ngfr T C 11: 95,580,982 N63S probably benign Het
Olfr1264 T A 2: 90,021,526 Y180F probably damaging Het
Olfr1347 A G 7: 6,488,520 L118P probably damaging Het
Olfr576 A G 7: 102,965,864 I255V probably benign Het
Olfr698 A T 7: 106,753,219 H56Q probably benign Het
Olfr814 C T 10: 129,874,098 V220I probably benign Het
P2rx7 T C 5: 122,673,795 S390P probably benign Het
Pcdhga4 A C 18: 37,687,741 Q781P probably benign Het
Phip G A 9: 82,908,862 S677F probably benign Het
Ptpdc1 C A 13: 48,586,789 V389F possibly damaging Het
Rab2a T A 4: 8,604,381 I161N probably benign Het
Rnf113a2 T A 12: 84,417,337 M1K probably null Het
Schip1 T C 3: 68,494,872 V122A probably benign Het
Sdr16c5 C A 4: 4,006,663 A210S probably benign Het
Sipa1l2 T C 8: 125,439,273 S1541G possibly damaging Het
Slc22a21 T C 11: 53,979,847 Y4C probably damaging Het
Smco1 C T 16: 32,273,774 H88Y probably damaging Het
Tll2 T C 19: 41,095,897 D697G probably damaging Het
Trim34a A G 7: 104,260,993 N334S possibly damaging Het
Ubqln1 A G 13: 58,199,033 I64T probably benign Het
Vstm2b T A 7: 40,902,488 probably null Het
Wdr17 A G 8: 54,687,604 F238L probably damaging Het
Wiz T C 17: 32,377,848 probably benign Het
Zfp407 T C 18: 84,561,309 S560G probably benign Het
Other mutations in Sh3bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Sh3bp1 APN 15 78905114 missense possibly damaging 0.58
IGL01879:Sh3bp1 APN 15 78907992 missense probably damaging 1.00
IGL02112:Sh3bp1 APN 15 78905884 critical splice donor site probably null
IGL02216:Sh3bp1 APN 15 78905164 missense probably benign 0.07
IGL02385:Sh3bp1 APN 15 78905888 splice site probably benign
IGL02417:Sh3bp1 APN 15 78901499 missense probably damaging 1.00
IGL02551:Sh3bp1 APN 15 78904338 missense probably benign 0.01
PIT1430001:Sh3bp1 UTSW 15 78914024 missense probably benign
PIT4585001:Sh3bp1 UTSW 15 78910076 missense possibly damaging 0.49
R0255:Sh3bp1 UTSW 15 78904334 nonsense probably null
R0318:Sh3bp1 UTSW 15 78911707 missense probably damaging 0.97
R0544:Sh3bp1 UTSW 15 78905775 missense probably damaging 1.00
R0554:Sh3bp1 UTSW 15 78907267 missense probably damaging 1.00
R1424:Sh3bp1 UTSW 15 78903699 critical splice donor site probably null
R1465:Sh3bp1 UTSW 15 78907345 splice site probably benign
R1813:Sh3bp1 UTSW 15 78903680 missense probably damaging 0.96
R1835:Sh3bp1 UTSW 15 78905150 missense probably damaging 1.00
R2291:Sh3bp1 UTSW 15 78918319 missense possibly damaging 0.93
R2415:Sh3bp1 UTSW 15 78901161 start gained probably benign
R2509:Sh3bp1 UTSW 15 78911506 missense probably damaging 1.00
R2511:Sh3bp1 UTSW 15 78911506 missense probably damaging 1.00
R3054:Sh3bp1 UTSW 15 78911422 missense probably benign 0.01
R3827:Sh3bp1 UTSW 15 78904497 missense possibly damaging 0.67
R3855:Sh3bp1 UTSW 15 78901161 start gained probably benign
R4767:Sh3bp1 UTSW 15 78904497 missense possibly damaging 0.67
R4787:Sh3bp1 UTSW 15 78907995 missense possibly damaging 0.80
R4852:Sh3bp1 UTSW 15 78904338 missense probably benign 0.01
R4872:Sh3bp1 UTSW 15 78908037 missense probably benign 0.31
R6320:Sh3bp1 UTSW 15 78911515 missense probably damaging 1.00
R6322:Sh3bp1 UTSW 15 78911515 missense probably damaging 1.00
R6569:Sh3bp1 UTSW 15 78911696 missense probably damaging 1.00
R6678:Sh3bp1 UTSW 15 78908514 critical splice donor site probably null
R6905:Sh3bp1 UTSW 15 78905030 missense probably benign 0.00
R7564:Sh3bp1 UTSW 15 78911560 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGATGACCCTGGAGAGG -3'
(R):5'- TAGGGATCTTGGAGACTACTGG -3'

Sequencing Primer
(F):5'- GGATGTCCTGCAGCCGC -3'
(R):5'- ATCTTGGAGACTACTGGTTTTCC -3'
Posted On2016-07-06