Incidental Mutation 'R5194:Smco1'
ID400022
Institutional Source Beutler Lab
Gene Symbol Smco1
Ensembl Gene ENSMUSG00000046345
Gene Namesingle-pass membrane protein with coiled-coil domains 1
Synonyms2310010M20Rik
MMRRC Submission 042770-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5194 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location32271468-32274781 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32273774 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 88 (H88Y)
Ref Sequence ENSEMBL: ENSMUSP00000090873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014218] [ENSMUST00000093183] [ENSMUST00000155649] [ENSMUST00000171474]
Predicted Effect probably benign
Transcript: ENSMUST00000014218
SMART Domains Protein: ENSMUSP00000014218
Gene: ENSMUSG00000014074

DomainStartEndE-ValueType
RING 16 54 8.23e-6 SMART
coiled coil region 114 184 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093183
AA Change: H88Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090873
Gene: ENSMUSG00000046345
AA Change: H88Y

DomainStartEndE-ValueType
Pfam:DUF4547 19 214 5e-120 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155649
SMART Domains Protein: ENSMUSP00000115807
Gene: ENSMUSG00000014074

DomainStartEndE-ValueType
RING 16 54 8.23e-6 SMART
coiled coil region 114 183 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171474
SMART Domains Protein: ENSMUSP00000126484
Gene: ENSMUSG00000014074

DomainStartEndE-ValueType
RING 18 56 8.23e-6 SMART
coiled coil region 116 186 N/A INTRINSIC
low complexity region 210 223 N/A INTRINSIC
Meta Mutation Damage Score 0.1553 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,250 N82D probably benign Het
Acadm C T 3: 153,933,118 R206H possibly damaging Het
Acly T A 11: 100,523,546 Y18F probably benign Het
Acnat2 G T 4: 49,380,452 Q291K probably benign Het
Agtpbp1 T C 13: 59,500,639 I456V probably benign Het
Ankrd7 A G 6: 18,868,077 N114S possibly damaging Het
Arfgef1 A T 1: 10,204,907 L307I probably benign Het
Arhgef2 A T 3: 88,635,649 I383F probably damaging Het
Cbs C T 17: 31,624,224 probably null Het
Cep135 T C 5: 76,615,777 V538A probably benign Het
D11Wsu47e T C 11: 113,688,828 S350P possibly damaging Het
Dennd5a T C 7: 109,933,729 E254G probably damaging Het
Drc7 T C 8: 95,061,717 V236A probably benign Het
Dtna C T 18: 23,590,245 Q169* probably null Het
Egfem1 G A 3: 29,357,196 probably null Het
Eif2ak3 T C 6: 70,858,478 S130P possibly damaging Het
Ewsr1 T C 11: 5,082,355 N297S unknown Het
F13a1 T G 13: 36,972,063 D192A probably damaging Het
Fam120a A G 13: 48,880,935 V1067A probably benign Het
Gm13124 A G 4: 144,555,082 V380A probably benign Het
Gm17490 T C 2: 11,626,251 Y5C unknown Het
Gm8587 C T 12: 88,089,786 noncoding transcript Het
H2-Ab1 C T 17: 34,269,378 probably benign Het
Hoxd12 T C 2: 74,675,103 L6P probably damaging Het
Ifi204 C T 1: 173,749,344 D564N possibly damaging Het
Irak2 T C 6: 113,690,790 V444A probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrba A C 3: 86,328,219 N877H probably damaging Het
Mylk3 T C 8: 85,352,866 I388V probably benign Het
Myo9b C T 8: 71,349,089 A1286V probably benign Het
Myt1l A C 12: 29,811,648 D143A unknown Het
Ngfr T C 11: 95,580,982 N63S probably benign Het
Olfr1264 T A 2: 90,021,526 Y180F probably damaging Het
Olfr1347 A G 7: 6,488,520 L118P probably damaging Het
Olfr576 A G 7: 102,965,864 I255V probably benign Het
Olfr698 A T 7: 106,753,219 H56Q probably benign Het
Olfr814 C T 10: 129,874,098 V220I probably benign Het
P2rx7 T C 5: 122,673,795 S390P probably benign Het
Pcdhga4 A C 18: 37,687,741 Q781P probably benign Het
Phip G A 9: 82,908,862 S677F probably benign Het
Ptpdc1 C A 13: 48,586,789 V389F possibly damaging Het
Rab2a T A 4: 8,604,381 I161N probably benign Het
Rnf113a2 T A 12: 84,417,337 M1K probably null Het
Schip1 T C 3: 68,494,872 V122A probably benign Het
Sdr16c5 C A 4: 4,006,663 A210S probably benign Het
Sh3bp1 A G 15: 78,903,101 K83E probably damaging Het
Sipa1l2 T C 8: 125,439,273 S1541G possibly damaging Het
Slc22a21 T C 11: 53,979,847 Y4C probably damaging Het
Tll2 T C 19: 41,095,897 D697G probably damaging Het
Trim34a A G 7: 104,260,993 N334S possibly damaging Het
Ubqln1 A G 13: 58,199,033 I64T probably benign Het
Vstm2b T A 7: 40,902,488 probably null Het
Wdr17 A G 8: 54,687,604 F238L probably damaging Het
Wiz T C 17: 32,377,848 probably benign Het
Zfp407 T C 18: 84,561,309 S560G probably benign Het
Other mutations in Smco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Smco1 APN 16 32274069 missense probably damaging 1.00
IGL01704:Smco1 APN 16 32273886 missense probably benign 0.26
IGL02000:Smco1 APN 16 32273933 missense possibly damaging 0.75
R0217:Smco1 UTSW 16 32273781 missense possibly damaging 0.77
R0602:Smco1 UTSW 16 32273244 missense probably damaging 0.98
R1794:Smco1 UTSW 16 32274132 missense probably benign 0.03
R1913:Smco1 UTSW 16 32273882 missense probably damaging 1.00
R1996:Smco1 UTSW 16 32273912 missense probably benign 0.00
R1998:Smco1 UTSW 16 32273840 missense probably damaging 1.00
R3801:Smco1 UTSW 16 32273898 missense probably benign 0.00
R3802:Smco1 UTSW 16 32273898 missense probably benign 0.00
R3915:Smco1 UTSW 16 32273765 missense probably benign 0.01
R5464:Smco1 UTSW 16 32273876 missense probably damaging 1.00
R5850:Smco1 UTSW 16 32273856 missense probably damaging 1.00
R6221:Smco1 UTSW 16 32273205 missense probably benign 0.00
R6267:Smco1 UTSW 16 32274014 missense probably benign 0.00
R6454:Smco1 UTSW 16 32273223 missense possibly damaging 0.46
R7068:Smco1 UTSW 16 32274111 missense probably benign 0.01
R7196:Smco1 UTSW 16 32273802 missense probably damaging 1.00
R7227:Smco1 UTSW 16 32274015 missense possibly damaging 0.93
R7517:Smco1 UTSW 16 32273967 missense possibly damaging 0.88
R7587:Smco1 UTSW 16 32273723 missense probably benign 0.01
Z1088:Smco1 UTSW 16 32273215 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCATACTTCCGAAATTCGC -3'
(R):5'- GTCTTACGTTGGCAGCATAGTG -3'

Sequencing Primer
(F):5'- ATACTTCCGAAATTCGCAGCTG -3'
(R):5'- CTCCTTTGTTGCCATGTACAATGAAG -3'
Posted On2016-07-06