Mutagenetix > Incidental Mutations

Incidental Mutation 'R5194:Zfp407'

400040

Institutional Source

Beutler Lab

Gene Symbol

Zfp407

Ensembl Gene

ENSMUSG00000048410

Gene Name

zinc finger protein 407

Synonyms

6430585N13Rik, LOC240469, LOC381139

MMRRC Submission

042770-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5194 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84128027-84589725 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84561309 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 560 (S560G)

Ref Sequence

ENSEMBL: ENSMUSP00000118361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000125763]

Predicted Effect

probably benign
Transcript: ENSMUST00000125450

Predicted Effect

probably benign
Transcript: ENSMUST00000125763
AA Change: S560G

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000118361
Gene: ENSMUSG00000048410
AA Change: S560G

Domain	Start	End	E-Value	Type
low complexity region	20	37	N/A	INTRINSIC
ZnF_C2H2	178	200	8.67e-1	SMART
ZnF_U1	233	267	6.79e-1	SMART
ZnF_C2H2	236	260	4.65e-1	SMART
ZnF_C2H2	522	545	7.05e-1	SMART
ZnF_U1	548	582	1.54e1	SMART
ZnF_C2H2	551	575	1.01e-1	SMART
ZnF_C2H2	582	605	1.41e0	SMART
ZnF_U1	606	639	2.22e0	SMART
ZnF_C2H2	609	632	1.01e2	SMART
ZnF_C2H2	695	718	6.23e-2	SMART
ZnF_U1	721	755	2.96e0	SMART
ZnF_C2H2	724	748	7.11e0	SMART
ZnF_C2H2	840	863	7.55e-1	SMART
ZnF_U1	866	900	3.81e-1	SMART
ZnF_C2H2	869	893	1.07e0	SMART
ZnF_C2H2	1009	1032	6.13e-1	SMART
ZnF_U1	1035	1069	2.22e0	SMART
ZnF_C2H2	1038	1062	5.62e0	SMART
low complexity region	1223	1234	N/A	INTRINSIC
ZnF_C2H2	1405	1428	5.92e0	SMART
ZnF_U1	1432	1466	2.35e0	SMART
ZnF_C2H2	1435	1459	1.76e-1	SMART
ZnF_C2H2	1477	1500	5.42e-2	SMART
ZnF_C2H2	1528	1552	1.68e1	SMART
ZnF_C2H2	1558	1580	1.43e-1	SMART
ZnF_C2H2	1586	1609	9.58e-3	SMART
ZnF_C2H2	1619	1641	2.61e-4	SMART
ZnF_C2H2	1647	1671	1.04e-3	SMART
ZnF_C2H2	1677	1699	9.44e-2	SMART
ZnF_C2H2	1705	1727	1.82e-3	SMART
ZnF_C2H2	1733	1758	4.65e-1	SMART
ZnF_C2H2	1764	1787	1.26e-2	SMART
low complexity region	1876	1887	N/A	INTRINSIC
low complexity region	2017	2032	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156181

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182297

Meta Mutation Damage Score

0.1533

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein whose exact function is not known. It may be involved in transcriptional regulation. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700122O11Rik	T	C	17: 48,037,250	N82D	probably benign	Het
Acadm	C	T	3: 153,933,118	R206H	possibly damaging	Het
Acly	T	A	11: 100,523,546	Y18F	probably benign	Het
Acnat2	G	T	4: 49,380,452	Q291K	probably benign	Het
Agtpbp1	T	C	13: 59,500,639	I456V	probably benign	Het
Ankrd7	A	G	6: 18,868,077	N114S	possibly damaging	Het
Arfgef1	A	T	1: 10,204,907	L307I	probably benign	Het
Arhgef2	A	T	3: 88,635,649	I383F	probably damaging	Het
Cbs	C	T	17: 31,624,224		probably null	Het
Cep135	T	C	5: 76,615,777	V538A	probably benign	Het
D11Wsu47e	T	C	11: 113,688,828	S350P	possibly damaging	Het
Dennd5a	T	C	7: 109,933,729	E254G	probably damaging	Het
Drc7	T	C	8: 95,061,717	V236A	probably benign	Het
Dtna	C	T	18: 23,590,245	Q169*	probably null	Het
Egfem1	G	A	3: 29,357,196		probably null	Het
Eif2ak3	T	C	6: 70,858,478	S130P	possibly damaging	Het
Ewsr1	T	C	11: 5,082,355	N297S	unknown	Het
F13a1	T	G	13: 36,972,063	D192A	probably damaging	Het
Fam120a	A	G	13: 48,880,935	V1067A	probably benign	Het
Gm13124	A	G	4: 144,555,082	V380A	probably benign	Het
Gm17490	T	C	2: 11,626,251	Y5C	unknown	Het
Gm8587	C	T	12: 88,089,786		noncoding transcript	Het
H2-Ab1	C	T	17: 34,269,378		probably benign	Het
Hoxd12	T	C	2: 74,675,103	L6P	probably damaging	Het
Ifi204	C	T	1: 173,749,344	D564N	possibly damaging	Het
Irak2	T	C	6: 113,690,790	V444A	probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrba	A	C	3: 86,328,219	N877H	probably damaging	Het
Mylk3	T	C	8: 85,352,866	I388V	probably benign	Het
Myo9b	C	T	8: 71,349,089	A1286V	probably benign	Het
Myt1l	A	C	12: 29,811,648	D143A	unknown	Het
Ngfr	T	C	11: 95,580,982	N63S	probably benign	Het
Olfr1264	T	A	2: 90,021,526	Y180F	probably damaging	Het
Olfr1347	A	G	7: 6,488,520	L118P	probably damaging	Het
Olfr576	A	G	7: 102,965,864	I255V	probably benign	Het
Olfr698	A	T	7: 106,753,219	H56Q	probably benign	Het
Olfr814	C	T	10: 129,874,098	V220I	probably benign	Het
P2rx7	T	C	5: 122,673,795	S390P	probably benign	Het
Pcdhga4	A	C	18: 37,687,741	Q781P	probably benign	Het
Phip	G	A	9: 82,908,862	S677F	probably benign	Het
Ptpdc1	C	A	13: 48,586,789	V389F	possibly damaging	Het
Rab2a	T	A	4: 8,604,381	I161N	probably benign	Het
Rnf113a2	T	A	12: 84,417,337	M1K	probably null	Het
Schip1	T	C	3: 68,494,872	V122A	probably benign	Het
Sdr16c5	C	A	4: 4,006,663	A210S	probably benign	Het
Sh3bp1	A	G	15: 78,903,101	K83E	probably damaging	Het
Sipa1l2	T	C	8: 125,439,273	S1541G	possibly damaging	Het
Slc22a21	T	C	11: 53,979,847	Y4C	probably damaging	Het
Smco1	C	T	16: 32,273,774	H88Y	probably damaging	Het
Tll2	T	C	19: 41,095,897	D697G	probably damaging	Het
Trim34a	A	G	7: 104,260,993	N334S	possibly damaging	Het
Ubqln1	A	G	13: 58,199,033	I64T	probably benign	Het
Vstm2b	T	A	7: 40,902,488		probably null	Het
Wdr17	A	G	8: 54,687,604	F238L	probably damaging	Het
Wiz	T	C	17: 32,377,848		probably benign	Het

Other mutations in Zfp407

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Zfp407	APN	18	84561752	missense	probably damaging	0.99
IGL02105:Zfp407	APN	18	84562720	nonsense	probably null
IGL02110:Zfp407	APN	18	84559040	missense	probably benign	0.00
IGL02343:Zfp407	APN	18	84209724	missense	possibly damaging	0.71
IGL02456:Zfp407	APN	18	84558641	missense	probably damaging	1.00
IGL02705:Zfp407	APN	18	84559031	nonsense	probably null
IGL02946:Zfp407	APN	18	84560709	missense	probably damaging	1.00
IGL03069:Zfp407	APN	18	84350975	missense	probably damaging	1.00
IGL03145:Zfp407	APN	18	84209721	missense	probably damaging	0.99
IGL03403:Zfp407	APN	18	84560797	missense	probably damaging	1.00
IGL03134:Zfp407	UTSW	18	84209955	missense	probably damaging	0.99
PIT4362001:Zfp407	UTSW	18	84561268	missense	possibly damaging	0.87
PIT4520001:Zfp407	UTSW	18	84432420	missense	probably damaging	0.99
R0087:Zfp407	UTSW	18	84560411	missense	probably damaging	1.00
R0243:Zfp407	UTSW	18	84558711	missense	probably damaging	1.00
R0594:Zfp407	UTSW	18	84562567	missense	possibly damaging	0.87
R0766:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R0787:Zfp407	UTSW	18	84209022	missense	probably damaging	1.00
R0787:Zfp407	UTSW	18	84209346	missense	probably benign	0.00
R1065:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1086:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1165:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1186:Zfp407	UTSW	18	84209448	missense	probably benign	0.39
R1203:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1312:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1345:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1385:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1421:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1430:Zfp407	UTSW	18	84209455	missense	probably benign	0.18
R1436:Zfp407	UTSW	18	84343071	splice site	probably benign
R1498:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1526:Zfp407	UTSW	18	84561033	missense	possibly damaging	0.61
R1579:Zfp407	UTSW	18	84209638	missense	probably benign	0.00
R1594:Zfp407	UTSW	18	84209331	missense	probably benign	0.01
R1628:Zfp407	UTSW	18	84354533	missense	probably damaging	1.00
R1698:Zfp407	UTSW	18	84562157	missense	probably damaging	1.00
R1962:Zfp407	UTSW	18	84559336	missense	probably benign	0.01
R1984:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1985:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1986:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R2151:Zfp407	UTSW	18	84209649	missense	possibly damaging	0.55
R2152:Zfp407	UTSW	18	84209649	missense	possibly damaging	0.55
R2154:Zfp407	UTSW	18	84209649	missense	possibly damaging	0.55
R2259:Zfp407	UTSW	18	84209793	missense	probably damaging	1.00
R2353:Zfp407	UTSW	18	84559880	missense	probably damaging	1.00
R2845:Zfp407	UTSW	18	84558397	nonsense	probably null
R3407:Zfp407	UTSW	18	84558872	missense	probably benign	0.08
R3432:Zfp407	UTSW	18	84208746	missense	probably damaging	1.00
R3892:Zfp407	UTSW	18	84560352	missense	probably damaging	1.00
R4026:Zfp407	UTSW	18	84559596	missense	possibly damaging	0.82
R4107:Zfp407	UTSW	18	84343007	missense	possibly damaging	0.82
R4398:Zfp407	UTSW	18	84562731	nonsense	probably null
R4447:Zfp407	UTSW	18	84562694	missense	possibly damaging	0.95
R4752:Zfp407	UTSW	18	84562914	missense	probably benign	0.01
R4881:Zfp407	UTSW	18	84559703	missense	probably benign	0.27
R4936:Zfp407	UTSW	18	84559464	missense	probably benign	0.00
R5243:Zfp407	UTSW	18	84561091	missense	probably damaging	1.00
R5258:Zfp407	UTSW	18	84315926	missense	probably damaging	1.00
R5591:Zfp407	UTSW	18	84561137	missense	probably damaging	1.00
R5633:Zfp407	UTSW	18	84561044	missense	probably benign	0.35
R5739:Zfp407	UTSW	18	84208742	makesense	probably null
R5806:Zfp407	UTSW	18	84558614	missense	probably damaging	1.00
R5820:Zfp407	UTSW	18	84560524	missense	probably benign	0.01
R6187:Zfp407	UTSW	18	84559009	missense	possibly damaging	0.87
R6512:Zfp407	UTSW	18	84560349	missense	probably damaging	1.00
R6521:Zfp407	UTSW	18	84432411	missense	probably damaging	1.00
R6748:Zfp407	UTSW	18	84208830	missense	probably damaging	0.98
R6882:Zfp407	UTSW	18	84343069	splice site	probably null
R6899:Zfp407	UTSW	18	84561434	missense	possibly damaging	0.86
R7038:Zfp407	UTSW	18	84561857	missense	probably damaging	1.00
R7076:Zfp407	UTSW	18	84558476	missense	probably damaging	1.00
R7326:Zfp407	UTSW	18	84559042	missense	possibly damaging	0.77
R7397:Zfp407	UTSW	18	84561819	missense	possibly damaging	0.59
R7402:Zfp407	UTSW	18	84561536	missense	probably benign	0.02
R7783:Zfp407	UTSW	18	84209922	missense	possibly damaging	0.69
R7800:Zfp407	UTSW	18	84560675	missense	probably damaging	0.99
R7904:Zfp407	UTSW	18	84561256	missense	not run
R7987:Zfp407	UTSW	18	84561256	missense	not run
RF003:Zfp407	UTSW	18	84209563	missense	probably benign	0.17
Z1177:Zfp407	UTSW	18	84209954	missense	not run

Predicted Primers

PCR Primer
(F):5'- TGAAGCCGTCTTTGGTTGAAC -3'
(R):5'- TGTCTTTCAGGCTCCACACG -3'

Sequencing Primer
(F):5'- AACTATTATGTGACTCGGTTGCTC -3'
(R):5'- TCCACACGGCTGGGCTC -3'

Posted On

2016-07-06