Incidental Mutation 'R5269:Brca2'
ID400052
Institutional Source Beutler Lab
Gene Symbol Brca2
Ensembl Gene ENSMUSG00000041147
Gene Namebreast cancer 2, early onset
SynonymsFancd1, RAB163
MMRRC Submission 042834-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5269 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location150522630-150570329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 150539223 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 817 (I817M)
Ref Sequence ENSEMBL: ENSMUSP00000144676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044620] [ENSMUST00000202003] [ENSMUST00000202313]
Predicted Effect probably benign
Transcript: ENSMUST00000044620
AA Change: I817M

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000038576
Gene: ENSMUSG00000041147
AA Change: I817M

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Pfam:BRCA2 982 1014 2.6e-13 PFAM
Pfam:BRCA2 1193 1225 3.9e-16 PFAM
low complexity region 1239 1252 N/A INTRINSIC
Pfam:BRCA2 1395 1425 1.4e-13 PFAM
Pfam:BRCA2 1492 1524 1.8e-13 PFAM
Pfam:BRCA2 1624 1655 8.4e-12 PFAM
Pfam:BRCA2 1925 1957 8e-15 PFAM
Pfam:BRCA2 2005 2037 1.7e-11 PFAM
Pfam:BRCA-2_helical 2402 2588 1.3e-94 PFAM
Pfam:BRCA-2_OB1 2591 2717 5.3e-44 PFAM
Tower 2752 2793 2.37e-18 SMART
Pfam:BRCA-2_OB3 2971 3104 1.5e-49 PFAM
low complexity region 3197 3208 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202003
AA Change: I817M

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144676
Gene: ENSMUSG00000041147
AA Change: I817M

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202313
AA Change: I817M

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000144150
Gene: ENSMUSG00000041147
AA Change: I817M

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Pfam:BRCA2 982 1014 2.6e-13 PFAM
Pfam:BRCA2 1193 1225 3.9e-16 PFAM
low complexity region 1239 1252 N/A INTRINSIC
Pfam:BRCA2 1395 1425 1.4e-13 PFAM
Pfam:BRCA2 1492 1524 1.8e-13 PFAM
Pfam:BRCA2 1624 1655 8.4e-12 PFAM
Pfam:BRCA2 1925 1957 8e-15 PFAM
Pfam:BRCA2 2005 2037 1.7e-11 PFAM
Pfam:BRCA-2_helical 2402 2588 1.3e-94 PFAM
Pfam:BRCA-2_OB1 2591 2717 5.3e-44 PFAM
Tower 2752 2793 2.37e-18 SMART
Pfam:BRCA-2_OB3 2971 3104 1.5e-49 PFAM
low complexity region 3197 3208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202975
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA2 protein survive, are small, infertile, show improper tissue differentiation and develop lymphomas and carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,376,743 S357P possibly damaging Het
Adam39 A G 8: 40,825,981 I470V probably benign Het
Agrn A T 4: 156,168,990 C1708S probably benign Het
Agtpbp1 A G 13: 59,473,743 I42T probably damaging Het
Akap6 T C 12: 53,139,843 C1347R probably damaging Het
Als2cr12 A G 1: 58,691,760 S46P possibly damaging Het
Antxr1 A G 6: 87,180,183 L452P probably damaging Het
Arhgef33 T A 17: 80,370,275 V417D probably damaging Het
Casp4 A T 9: 5,321,521 probably benign Het
Cdh20 T C 1: 104,934,157 Y21H possibly damaging Het
Cdr2 C T 7: 120,958,334 V323M possibly damaging Het
Cebpa G A 7: 35,119,858 R147H probably benign Het
Cetn4 C A 3: 37,309,969 E31* probably null Het
Cobll1 G A 2: 65,133,771 Q189* probably null Het
Colec12 A G 18: 9,846,825 T74A possibly damaging Het
Crisp4 A G 1: 18,128,710 S124P probably damaging Het
Eddm3b T A 14: 51,116,721 D55E probably damaging Het
Elmo1 C A 13: 20,449,486 N439K probably benign Het
Fabp12 T C 3: 10,250,107 N60S probably benign Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat2 T A 11: 55,287,878 H1452L probably benign Het
Flrt2 T C 12: 95,779,938 V350A possibly damaging Het
Ganab T C 19: 8,911,937 F626S probably damaging Het
Ghr T C 15: 3,320,079 Y539C probably benign Het
Gm6871 T C 7: 41,548,101 T112A probably damaging Het
Gm7133 T A 1: 97,183,123 noncoding transcript Het
Gon4l A C 3: 88,895,528 I1149L probably benign Het
Greb1l G A 18: 10,511,409 D45N probably benign Het
H2-K1 A G 17: 33,997,015 probably benign Het
Herc2 C T 7: 56,168,870 R2770* probably null Het
Itsn2 A G 12: 4,633,553 probably benign Het
Klb A G 5: 65,348,797 D129G probably damaging Het
Klf1 A G 8: 84,903,340 I265V probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Map3k10 T C 7: 27,658,532 E607G probably benign Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Mroh6 A G 15: 75,885,790 L457P probably damaging Het
Mrpl21 T A 19: 3,287,012 C128S probably damaging Het
Olfr564 T C 7: 102,804,120 V214A probably benign Het
Paqr4 G T 17: 23,738,213 H105Q probably damaging Het
Pcdhga10 A G 18: 37,748,694 I503V probably benign Het
Pds5a T C 5: 65,663,928 N151S probably damaging Het
Pif1 A G 9: 65,591,829 T444A possibly damaging Het
Ppp2r3a T C 9: 101,153,865 R851G probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Ros1 T G 10: 52,051,008 Q2172P probably damaging Het
Rpe65 A G 3: 159,604,347 T86A probably benign Het
Rpl18a G A 8: 70,896,288 R15C possibly damaging Het
Sh3tc2 A G 18: 61,975,613 K258R probably benign Het
Ska3 T A 14: 57,822,116 E84V possibly damaging Het
Slc25a40 T A 5: 8,447,409 probably null Het
Slf1 A T 13: 77,104,581 S274T probably benign Het
Spata21 A T 4: 141,103,021 Q267H probably damaging Het
Strbp A T 2: 37,627,443 W207R possibly damaging Het
Taf6l T C 19: 8,774,962 E454G probably damaging Het
Tcam1 C A 11: 106,285,527 L360I probably benign Het
Tnxb G A 17: 34,703,608 R2465H possibly damaging Het
Trim66 T A 7: 109,457,590 Y1120F probably benign Het
Trp53 T A 11: 69,589,205 M243K probably damaging Het
Ttl T A 2: 129,068,911 C72S probably damaging Het
Ttn A G 2: 76,708,896 V34582A probably benign Het
Uqcrh T C 4: 116,069,904 T31A possibly damaging Het
Usp40 A G 1: 87,995,782 C256R probably benign Het
Vmn1r168 A G 7: 23,541,414 E232G probably benign Het
Wdr72 A T 9: 74,157,371 I562F probably damaging Het
Wnt4 A G 4: 137,277,750 N24S probably benign Het
Other mutations in Brca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Brca2 APN 5 150539898 missense probably benign 0.18
IGL00392:Brca2 APN 5 150541240 missense probably benign 0.02
IGL00557:Brca2 APN 5 150560538 missense probably benign
IGL00798:Brca2 APN 5 150539463 missense probably benign 0.30
IGL00933:Brca2 APN 5 150542404 missense probably benign 0.04
IGL00964:Brca2 APN 5 150532310 missense probably damaging 1.00
IGL01152:Brca2 APN 5 150542390 missense probably damaging 0.99
IGL01577:Brca2 APN 5 150541620 nonsense probably null
IGL01585:Brca2 APN 5 150539516 missense possibly damaging 0.76
IGL01732:Brca2 APN 5 150542387 missense probably benign 0.13
IGL01809:Brca2 APN 5 150531061 splice site probably null
IGL01911:Brca2 APN 5 150567613 missense probably damaging 0.96
IGL02113:Brca2 APN 5 150540979 missense possibly damaging 0.95
IGL02313:Brca2 APN 5 150538661 missense probably damaging 1.00
IGL02342:Brca2 APN 5 150542824 missense possibly damaging 0.94
IGL02508:Brca2 APN 5 150543308 missense possibly damaging 0.85
IGL02532:Brca2 APN 5 150550862 missense probably damaging 1.00
IGL02646:Brca2 APN 5 150560790 missense possibly damaging 0.89
IGL02738:Brca2 APN 5 150567035 missense probably damaging 1.00
IGL02833:Brca2 APN 5 150541790 missense possibly damaging 0.83
IGL02871:Brca2 APN 5 150542552 missense probably benign 0.13
IGL02995:Brca2 APN 5 150529488 missense probably damaging 1.00
IGL03105:Brca2 APN 5 150560485 missense probably benign 0.02
R0219:Brca2 UTSW 5 150523175 splice site probably benign
R0416:Brca2 UTSW 5 150569392 missense possibly damaging 0.93
R0441:Brca2 UTSW 5 150541857 missense probably damaging 0.96
R0548:Brca2 UTSW 5 150544935 missense probably damaging 0.96
R0745:Brca2 UTSW 5 150544882 splice site probably benign
R0799:Brca2 UTSW 5 150560193 missense probably damaging 0.99
R1165:Brca2 UTSW 5 150542747 missense probably damaging 0.98
R1247:Brca2 UTSW 5 150541274 missense probably damaging 1.00
R1403:Brca2 UTSW 5 150542649 missense probably benign 0.22
R1403:Brca2 UTSW 5 150542649 missense probably benign 0.22
R1444:Brca2 UTSW 5 150542450 missense probably benign
R1466:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1466:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1584:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1599:Brca2 UTSW 5 150548713 nonsense probably null
R1600:Brca2 UTSW 5 150560830 splice site probably benign
R1822:Brca2 UTSW 5 150540198 missense probably benign 0.06
R1824:Brca2 UTSW 5 150536922 missense possibly damaging 0.94
R2037:Brca2 UTSW 5 150540669 missense probably benign
R2131:Brca2 UTSW 5 150557129 missense probably damaging 1.00
R2203:Brca2 UTSW 5 150539502 missense possibly damaging 0.58
R2208:Brca2 UTSW 5 150532344 missense probably damaging 0.96
R2293:Brca2 UTSW 5 150560534 missense possibly damaging 0.86
R2517:Brca2 UTSW 5 150539672 missense probably benign 0.04
R2566:Brca2 UTSW 5 150541762 missense probably benign 0.03
R3422:Brca2 UTSW 5 150543121 missense possibly damaging 0.91
R3917:Brca2 UTSW 5 150540827 missense probably damaging 0.96
R3946:Brca2 UTSW 5 150536704 missense probably damaging 0.96
R4176:Brca2 UTSW 5 150539633 nonsense probably null
R4255:Brca2 UTSW 5 150541169 missense possibly damaging 0.92
R4450:Brca2 UTSW 5 150536053 missense probably damaging 0.96
R4603:Brca2 UTSW 5 150536165 missense possibly damaging 0.86
R4681:Brca2 UTSW 5 150552398 splice site probably null
R4755:Brca2 UTSW 5 150559987 intron probably null
R4762:Brca2 UTSW 5 150531116 missense probably benign 0.00
R4824:Brca2 UTSW 5 150539735 missense probably damaging 1.00
R4887:Brca2 UTSW 5 150556937 missense probably damaging 1.00
R5020:Brca2 UTSW 5 150560436 missense probably damaging 1.00
R5159:Brca2 UTSW 5 150542108 missense possibly damaging 0.93
R5216:Brca2 UTSW 5 150542980 missense probably damaging 0.99
R5274:Brca2 UTSW 5 150539689 missense probably benign 0.00
R5589:Brca2 UTSW 5 150557132 missense possibly damaging 0.67
R5619:Brca2 UTSW 5 150557114 missense probably damaging 0.96
R5641:Brca2 UTSW 5 150556899 missense probably damaging 1.00
R5686:Brca2 UTSW 5 150540904 missense probably benign 0.00
R5730:Brca2 UTSW 5 150569005 missense possibly damaging 0.85
R5763:Brca2 UTSW 5 150548006 missense possibly damaging 0.85
R5877:Brca2 UTSW 5 150543221 missense possibly damaging 0.53
R5893:Brca2 UTSW 5 150569138 missense probably benign 0.02
R5900:Brca2 UTSW 5 150541132 missense probably benign 0.01
R5926:Brca2 UTSW 5 150534622 missense probably benign 0.07
R5966:Brca2 UTSW 5 150543251 missense probably damaging 0.99
R6025:Brca2 UTSW 5 150541575 frame shift probably null
R6062:Brca2 UTSW 5 150556889 missense probably damaging 0.96
R6141:Brca2 UTSW 5 150540637 missense possibly damaging 0.91
R6244:Brca2 UTSW 5 150566978 missense probably benign 0.08
R6508:Brca2 UTSW 5 150536593 missense possibly damaging 0.91
R6519:Brca2 UTSW 5 150540979 missense probably damaging 0.99
R6611:Brca2 UTSW 5 150536193 missense probably damaging 0.99
R6698:Brca2 UTSW 5 150532394 missense probably damaging 1.00
R6856:Brca2 UTSW 5 150540208 missense possibly damaging 0.68
R6912:Brca2 UTSW 5 150541742 missense probably damaging 0.99
R7002:Brca2 UTSW 5 150539918 missense probably benign
R7025:Brca2 UTSW 5 150540478 missense probably benign 0.39
R7151:Brca2 UTSW 5 150541436 missense probably benign 0.12
R7202:Brca2 UTSW 5 150532354 missense probably benign 0.03
R7365:Brca2 UTSW 5 150532337 missense probably damaging 0.99
R7510:Brca2 UTSW 5 150536691 missense possibly damaging 0.85
R7612:Brca2 UTSW 5 150540611 missense probably benign 0.03
R7682:Brca2 UTSW 5 150543153 missense probably benign
R7890:Brca2 UTSW 5 150539381 missense possibly damaging 0.83
R7973:Brca2 UTSW 5 150539381 missense possibly damaging 0.83
R8054:Brca2 UTSW 5 150536504 missense not run
R8056:Brca2 UTSW 5 150569306 missense not run
Z1088:Brca2 UTSW 5 150542763 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGCAGACATGGTTTCTAGAG -3'
(R):5'- TGAGACTAGGCCCTTGTGTG -3'

Sequencing Primer
(F):5'- TCTAGAGAGAAAATGTGTAAAATGCC -3'
(R):5'- GTTCCACTGAACTTCCTAAATCAGG -3'
Posted On2016-07-06