Mutagenetix > Incidental Mutations

Incidental Mutation 'R5195:Spag17'

400059

Institutional Source

Beutler Lab

Gene Symbol

Spag17

Ensembl Gene

ENSMUSG00000027867

Gene Name

sperm associated antigen 17

Synonyms

4931427F14Rik, PF6

MMRRC Submission

042771-MU

Accession Numbers

Genbank: NM_028892; MGI: 1921612

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5195 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99885406-100143322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100101388 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 1945 (Y1945H)

Ref Sequence

ENSEMBL: ENSMUSP00000134066 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164539]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137776

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145279

Predicted Effect

probably benign
Transcript: ENSMUST00000164539
AA Change: Y1945H

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867
AA Change: Y1945H

Domain	Start	End	E-Value	Type
low complexity region	155	170	N/A	INTRINSIC
low complexity region	384	400	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
coiled coil region	909	964	N/A	INTRINSIC
coiled coil region	1079	1120	N/A	INTRINSIC
low complexity region	1179	1190	N/A	INTRINSIC
low complexity region	1192	1205	N/A	INTRINSIC
low complexity region	1209	1220	N/A	INTRINSIC
low complexity region	1223	1238	N/A	INTRINSIC
low complexity region	1394	1405	N/A	INTRINSIC
low complexity region	1931	1942	N/A	INTRINSIC
Pfam:PapD-like	2171	2277	1.2e-15	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

97% (72/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700023F06Rik	T	C	11: 103,198,968	Y381C	probably damaging	Het
Apoo-ps	T	C	13: 107,414,553		noncoding transcript	Het
Arhgef40	T	A	14: 51,989,812	S438T	possibly damaging	Het
Barhl2	A	G	5: 106,453,439	L358P	possibly damaging	Het
Bicra	G	A	7: 15,979,953	P775S	possibly damaging	Het
Ccdc78	T	A	17: 25,789,988		probably null	Het
Ccnb1-ps	T	A	7: 42,106,098		noncoding transcript	Het
Cct6a	A	T	5: 129,794,655		noncoding transcript	Het
Cep120	T	A	18: 53,721,698	H455L	probably damaging	Het
Cobl	C	T	11: 12,253,565	V964I	probably benign	Het
Cpt1a	A	T	19: 3,383,800	I761F	possibly damaging	Het
Crk	T	A	11: 75,679,463	Y14N	probably damaging	Het
Deup1	A	T	9: 15,575,191	Y398N	possibly damaging	Het
Epha3	C	T	16: 63,546,147	G980D	possibly damaging	Het
Fam196a	A	T	7: 134,884,416	F469I	probably damaging	Het
Fanca	A	G	8: 123,303,945		probably benign	Het
Gbp4	T	A	5: 105,119,532	D507V	probably benign	Het
Gtf2i	A	T	5: 134,244,832	L740*	probably null	Het
Hmgn2	C	A	4: 133,967,286	A8S	probably benign	Het
Hook2	A	T	8: 84,994,776	N252I	probably damaging	Het
Igkv19-93	T	A	6: 68,736,526	T39S	probably damaging	Het
Inpp5j	A	C	11: 3,499,889		probably null	Het
Kbtbd3	G	C	9: 4,316,905	E19Q	possibly damaging	Het
Kcns2	G	A	15: 34,839,531	A347T	possibly damaging	Het
Klhl31	A	G	9: 77,650,290	E96G	possibly damaging	Het
Kptn	A	G	7: 16,123,103	Y172C	probably damaging	Het
Krt86	T	A	15: 101,476,933	M328K	probably benign	Het
Lama1	A	G	17: 67,764,800	D894G	probably benign	Het
Lars2	T	C	9: 123,453,310	V653A	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lhcgr	A	T	17: 88,742,946	V384D	probably damaging	Het
Malrd1	C	T	2: 16,150,810	T2010M	unknown	Het
Maml2	T	A	9: 13,621,114	N541K	probably damaging	Het
Med24	T	C	11: 98,710,281	K585R	possibly damaging	Het
Muc20	G	A	16: 32,794,476	S177L	unknown	Het
Mylk	T	A	16: 34,979,215	F1658L	probably damaging	Het
Obscn	C	T	11: 59,060,850	V4392I	possibly damaging	Het
Olfr744	T	C	14: 50,618,786	L188P	probably damaging	Het
Olfr975	A	G	9: 39,950,679	S31P	probably benign	Het
Pcnx2	A	T	8: 125,801,549	F1311I	possibly damaging	Het
Pcsk1	T	C	13: 75,126,855	L521P	probably damaging	Het
Pde4a	A	G	9: 21,204,333	T445A	possibly damaging	Het
Pgam5	A	T	5: 110,265,988	L103*	probably null	Het
Pkd2	G	A	5: 104,486,681	R526Q	probably benign	Het
Polr2a	T	C	11: 69,744,079	Y618C	probably damaging	Het
Pramef25	T	A	4: 143,950,880	E43V	probably damaging	Het
Pramel5	T	A	4: 144,271,741	M311L	probably benign	Het
Rbbp8	T	C	18: 11,722,151	F478L	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Ryk	T	C	9: 102,867,613	V122A	probably benign	Het
Sik3	G	T	9: 46,208,844		probably null	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Slc35e4	T	A	11: 3,912,872	I106F	possibly damaging	Het
Slc41a3	T	C	6: 90,633,671	S172P	probably damaging	Het
Snrnp70	T	A	7: 45,394,710	K32N	probably damaging	Het
St7	A	G	6: 17,743,637		probably benign	Het
Stab1	C	A	14: 31,140,521		probably benign	Het
Taf13	G	A	3: 108,581,074	R91Q	probably damaging	Het
Tmem200a	T	C	10: 26,078,956		probably benign	Het
Tnc	A	T	4: 63,967,252	L1871Q	probably damaging	Het
Toe1	T	C	4: 116,804,655	H439R	probably damaging	Het
Trpm1	T	C	7: 64,237,693	V893A	possibly damaging	Het
Ubr3	G	A	2: 69,956,034	A831T	probably benign	Het
Wdr89	C	T	12: 75,633,288	R64Q	probably benign	Het
Zbed5	G	T	5: 129,902,178	V323F	probably benign	Het
Zeb2	T	C	2: 45,001,635	R287G	probably damaging	Het

Other mutations in Spag17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01096:Spag17	APN	3	100063375	missense	probably benign	0.00
IGL01143:Spag17	APN	3	99939298	missense	probably benign	0.00
IGL01329:Spag17	APN	3	100095549	missense	probably benign	0.16
IGL01393:Spag17	APN	3	100027610	missense	possibly damaging	0.53
IGL01617:Spag17	APN	3	100109508	missense	possibly damaging	0.65
IGL01705:Spag17	APN	3	100022730	missense	probably benign	0.01
IGL01928:Spag17	APN	3	99940074	splice site	probably benign
IGL01981:Spag17	APN	3	100058833	missense	probably benign	0.03
IGL02435:Spag17	APN	3	99982444	missense	possibly damaging	0.53
IGL02452:Spag17	APN	3	100027391	missense	probably benign	0.00
IGL02465:Spag17	APN	3	100075871	missense	probably damaging	0.96
IGL02615:Spag17	APN	3	100072085	missense	probably benign	0.09
IGL02751:Spag17	APN	3	100010794	nonsense	probably null
IGL02803:Spag17	APN	3	100109397	missense	probably benign
IGL02898:Spag17	APN	3	100101386	missense	probably benign	0.00
IGL03037:Spag17	APN	3	100072170	splice site	probably null
IGL03068:Spag17	APN	3	100080205	missense	probably benign	0.35
IGL03131:Spag17	APN	3	100010759	missense	possibly damaging	0.85
IGL03224:Spag17	APN	3	100010840	missense	possibly damaging	0.53
FR4342:Spag17	UTSW	3	100056249	small insertion	probably benign
FR4342:Spag17	UTSW	3	100056252	small insertion	probably benign
FR4548:Spag17	UTSW	3	100056254	small insertion	probably benign
FR4589:Spag17	UTSW	3	100056245	small insertion	probably benign
FR4589:Spag17	UTSW	3	100056258	small insertion	probably benign
FR4737:Spag17	UTSW	3	100056257	small insertion	probably benign
FR4976:Spag17	UTSW	3	100056254	small insertion	probably benign
FR4976:Spag17	UTSW	3	100056255	small insertion	probably benign
N/A:Spag17	UTSW	3	99982254	splice site	probably benign
PIT4504001:Spag17	UTSW	3	100103110	critical splice acceptor site	probably null
PIT4514001:Spag17	UTSW	3	100013211	missense	possibly damaging	0.53
R0107:Spag17	UTSW	3	100050787	missense	possibly damaging	0.72
R0230:Spag17	UTSW	3	100106827	missense	probably benign	0.08
R0243:Spag17	UTSW	3	100085368	missense	probably benign	0.04
R0321:Spag17	UTSW	3	100101403	missense	probably damaging	0.99
R0375:Spag17	UTSW	3	100027590	missense	probably benign
R0417:Spag17	UTSW	3	100065554	missense	probably benign	0.11
R0490:Spag17	UTSW	3	99982411	missense	probably damaging	0.97
R0537:Spag17	UTSW	3	100125302	missense	probably damaging	0.98
R0714:Spag17	UTSW	3	100080156	missense	probably damaging	0.97
R0844:Spag17	UTSW	3	100004785	missense	probably benign
R0919:Spag17	UTSW	3	100071943	splice site	probably benign
R0926:Spag17	UTSW	3	100072116	missense	probably benign
R1037:Spag17	UTSW	3	100103117	missense	probably benign	0.01
R1075:Spag17	UTSW	3	100093676	missense	probably damaging	0.99
R1109:Spag17	UTSW	3	100027351	missense	possibly damaging	0.86
R1213:Spag17	UTSW	3	100095638	missense	probably benign	0.01
R1221:Spag17	UTSW	3	99982268	missense	possibly damaging	0.72
R1576:Spag17	UTSW	3	99939363	missense	possibly damaging	0.73
R1586:Spag17	UTSW	3	100021752	missense	possibly damaging	0.53
R1768:Spag17	UTSW	3	100027352	missense	possibly damaging	0.53
R1782:Spag17	UTSW	3	100010754	missense	probably benign	0.02
R1789:Spag17	UTSW	3	99939356	missense	possibly damaging	0.73
R1945:Spag17	UTSW	3	99939982	missense	probably benign
R2065:Spag17	UTSW	3	100013208	missense	probably benign	0.03
R2118:Spag17	UTSW	3	100049240	missense	possibly damaging	0.72
R2265:Spag17	UTSW	3	100061866	splice site	probably null
R2266:Spag17	UTSW	3	100061866	splice site	probably null
R2267:Spag17	UTSW	3	100061866	splice site	probably null
R2268:Spag17	UTSW	3	100061866	splice site	probably null
R2271:Spag17	UTSW	3	100106797	missense	probably damaging	1.00
R2389:Spag17	UTSW	3	100106837	missense	probably benign	0.27
R2420:Spag17	UTSW	3	100027619	missense	probably benign
R2422:Spag17	UTSW	3	100027619	missense	probably benign
R2423:Spag17	UTSW	3	100103456	missense	probably benign
R3407:Spag17	UTSW	3	100085299	missense	probably benign	0.09
R3801:Spag17	UTSW	3	100053853	missense	possibly damaging	0.53
R3856:Spag17	UTSW	3	100106759	missense	probably damaging	1.00
R4021:Spag17	UTSW	3	100049230	missense	probably benign	0.00
R4022:Spag17	UTSW	3	100049230	missense	probably benign	0.00
R4408:Spag17	UTSW	3	100103378	missense	probably benign
R4468:Spag17	UTSW	3	100085366	missense	probably damaging	0.98
R4540:Spag17	UTSW	3	100088381	missense	probably damaging	1.00
R4621:Spag17	UTSW	3	100103243	missense	probably benign	0.08
R4622:Spag17	UTSW	3	100103243	missense	probably benign	0.08
R4756:Spag17	UTSW	3	100103385	missense	possibly damaging	0.68
R4797:Spag17	UTSW	3	99984479	missense	possibly damaging	0.70
R4855:Spag17	UTSW	3	100063333	missense	probably benign	0.02
R4887:Spag17	UTSW	3	100050831	missense	probably damaging	1.00
R4962:Spag17	UTSW	3	100027623	missense	probably benign
R5030:Spag17	UTSW	3	100085341	nonsense	probably null
R5042:Spag17	UTSW	3	100072149	missense	probably damaging	1.00
R5074:Spag17	UTSW	3	100080118	missense	possibly damaging	0.94
R5200:Spag17	UTSW	3	100063471	nonsense	probably null
R5267:Spag17	UTSW	3	100061948	missense	probably damaging	0.98
R5360:Spag17	UTSW	3	100109410	missense	probably benign	0.00
R5444:Spag17	UTSW	3	100056152	missense	probably benign	0.06
R5498:Spag17	UTSW	3	100103345	missense	possibly damaging	0.83
R5503:Spag17	UTSW	3	100027244	missense	possibly damaging	0.72
R5540:Spag17	UTSW	3	100056272	missense	possibly damaging	0.91
R5547:Spag17	UTSW	3	100056152	missense	probably benign	0.06
R5575:Spag17	UTSW	3	100053822	missense	possibly damaging	0.85
R5629:Spag17	UTSW	3	100080119	missense	probably benign	0.33
R5639:Spag17	UTSW	3	100056166	missense	probably damaging	1.00
R5842:Spag17	UTSW	3	99939250	missense	possibly damaging	0.85
R5976:Spag17	UTSW	3	100095791	nonsense	probably null
R6082:Spag17	UTSW	3	100124185	missense	possibly damaging	0.46
R6228:Spag17	UTSW	3	100022602	missense	probably benign	0.33
R6254:Spag17	UTSW	3	100065585	missense	probably benign	0.03
R6321:Spag17	UTSW	3	100088427	missense	probably benign	0.05
R6446:Spag17	UTSW	3	100103132	missense	probably benign
R6687:Spag17	UTSW	3	100092950	missense	probably benign	0.07
R6853:Spag17	UTSW	3	100013235	missense	possibly damaging	0.86
R6946:Spag17	UTSW	3	100004683	missense	possibly damaging	0.53
R6953:Spag17	UTSW	3	100034975	missense	possibly damaging	0.53
R7038:Spag17	UTSW	3	99984609	missense	probably benign	0.00
R7084:Spag17	UTSW	3	99939270	missense	probably benign	0.18
R7126:Spag17	UTSW	3	100101435	missense	probably benign	0.00
R7144:Spag17	UTSW	3	100027401	splice site	probably null
R7198:Spag17	UTSW	3	100095572	missense	probably benign	0.02
R7318:Spag17	UTSW	3	99939983	missense	probably benign	0.00
R7403:Spag17	UTSW	3	99939375	missense	possibly damaging	0.53
R7409:Spag17	UTSW	3	100027231	missense	possibly damaging	0.73
R7409:Spag17	UTSW	3	100034159	missense	probably benign	0.00
R7537:Spag17	UTSW	3	99939247	missense	possibly damaging	0.96
R7609:Spag17	UTSW	3	100095595	nonsense	probably null
X0025:Spag17	UTSW	3	100101451	missense	probably benign	0.31
Z1088:Spag17	UTSW	3	100095630	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- GCCCTGGAGTTCTTGAAAATTCAG -3'
(R):5'- ACCAGCTACATCTGAAGGGG -3'

Sequencing Primer
(F):5'- CTGGAGTTCTTGAAAATTCAGGATAC -3'
(R):5'- CTACATCTGAAGGGGCTGTATTGAC -3'

Posted On

2016-07-06