Incidental Mutation 'R5195:Spag17'
ID400059
Institutional Source Beutler Lab
Gene Symbol Spag17
Ensembl Gene ENSMUSG00000027867
Gene Namesperm associated antigen 17
Synonyms4931427F14Rik, PF6
MMRRC Submission 042771-MU
Accession Numbers

Genbank: NM_028892; MGI: 1921612

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5195 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location99885406-100143322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100101388 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1945 (Y1945H)
Ref Sequence ENSEMBL: ENSMUSP00000134066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164539]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145279
Predicted Effect probably benign
Transcript: ENSMUST00000164539
AA Change: Y1945H

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867
AA Change: Y1945H

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
low complexity region 384 400 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
coiled coil region 909 964 N/A INTRINSIC
coiled coil region 1079 1120 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1192 1205 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1223 1238 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1931 1942 N/A INTRINSIC
Pfam:PapD-like 2171 2277 1.2e-15 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,198,968 Y381C probably damaging Het
Apoo-ps T C 13: 107,414,553 noncoding transcript Het
Arhgef40 T A 14: 51,989,812 S438T possibly damaging Het
Barhl2 A G 5: 106,453,439 L358P possibly damaging Het
Bicra G A 7: 15,979,953 P775S possibly damaging Het
Ccdc78 T A 17: 25,789,988 probably null Het
Ccnb1-ps T A 7: 42,106,098 noncoding transcript Het
Cct6a A T 5: 129,794,655 noncoding transcript Het
Cep120 T A 18: 53,721,698 H455L probably damaging Het
Cobl C T 11: 12,253,565 V964I probably benign Het
Cpt1a A T 19: 3,383,800 I761F possibly damaging Het
Crk T A 11: 75,679,463 Y14N probably damaging Het
Deup1 A T 9: 15,575,191 Y398N possibly damaging Het
Epha3 C T 16: 63,546,147 G980D possibly damaging Het
Fam196a A T 7: 134,884,416 F469I probably damaging Het
Fanca A G 8: 123,303,945 probably benign Het
Gbp4 T A 5: 105,119,532 D507V probably benign Het
Gtf2i A T 5: 134,244,832 L740* probably null Het
Hmgn2 C A 4: 133,967,286 A8S probably benign Het
Hook2 A T 8: 84,994,776 N252I probably damaging Het
Igkv19-93 T A 6: 68,736,526 T39S probably damaging Het
Inpp5j A C 11: 3,499,889 probably null Het
Kbtbd3 G C 9: 4,316,905 E19Q possibly damaging Het
Kcns2 G A 15: 34,839,531 A347T possibly damaging Het
Klhl31 A G 9: 77,650,290 E96G possibly damaging Het
Kptn A G 7: 16,123,103 Y172C probably damaging Het
Krt86 T A 15: 101,476,933 M328K probably benign Het
Lama1 A G 17: 67,764,800 D894G probably benign Het
Lars2 T C 9: 123,453,310 V653A probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lhcgr A T 17: 88,742,946 V384D probably damaging Het
Malrd1 C T 2: 16,150,810 T2010M unknown Het
Maml2 T A 9: 13,621,114 N541K probably damaging Het
Med24 T C 11: 98,710,281 K585R possibly damaging Het
Muc20 G A 16: 32,794,476 S177L unknown Het
Mylk T A 16: 34,979,215 F1658L probably damaging Het
Obscn C T 11: 59,060,850 V4392I possibly damaging Het
Olfr744 T C 14: 50,618,786 L188P probably damaging Het
Olfr975 A G 9: 39,950,679 S31P probably benign Het
Pcnx2 A T 8: 125,801,549 F1311I possibly damaging Het
Pcsk1 T C 13: 75,126,855 L521P probably damaging Het
Pde4a A G 9: 21,204,333 T445A possibly damaging Het
Pgam5 A T 5: 110,265,988 L103* probably null Het
Pkd2 G A 5: 104,486,681 R526Q probably benign Het
Polr2a T C 11: 69,744,079 Y618C probably damaging Het
Pramef25 T A 4: 143,950,880 E43V probably damaging Het
Pramel5 T A 4: 144,271,741 M311L probably benign Het
Rbbp8 T C 18: 11,722,151 F478L probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryk T C 9: 102,867,613 V122A probably benign Het
Sik3 G T 9: 46,208,844 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc35e4 T A 11: 3,912,872 I106F possibly damaging Het
Slc41a3 T C 6: 90,633,671 S172P probably damaging Het
Snrnp70 T A 7: 45,394,710 K32N probably damaging Het
St7 A G 6: 17,743,637 probably benign Het
Stab1 C A 14: 31,140,521 probably benign Het
Taf13 G A 3: 108,581,074 R91Q probably damaging Het
Tmem200a T C 10: 26,078,956 probably benign Het
Tnc A T 4: 63,967,252 L1871Q probably damaging Het
Toe1 T C 4: 116,804,655 H439R probably damaging Het
Trpm1 T C 7: 64,237,693 V893A possibly damaging Het
Ubr3 G A 2: 69,956,034 A831T probably benign Het
Wdr89 C T 12: 75,633,288 R64Q probably benign Het
Zbed5 G T 5: 129,902,178 V323F probably benign Het
Zeb2 T C 2: 45,001,635 R287G probably damaging Het
Other mutations in Spag17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Spag17 APN 3 100063375 missense probably benign 0.00
IGL01143:Spag17 APN 3 99939298 missense probably benign 0.00
IGL01329:Spag17 APN 3 100095549 missense probably benign 0.16
IGL01393:Spag17 APN 3 100027610 missense possibly damaging 0.53
IGL01617:Spag17 APN 3 100109508 missense possibly damaging 0.65
IGL01705:Spag17 APN 3 100022730 missense probably benign 0.01
IGL01928:Spag17 APN 3 99940074 splice site probably benign
IGL01981:Spag17 APN 3 100058833 missense probably benign 0.03
IGL02435:Spag17 APN 3 99982444 missense possibly damaging 0.53
IGL02452:Spag17 APN 3 100027391 missense probably benign 0.00
IGL02465:Spag17 APN 3 100075871 missense probably damaging 0.96
IGL02615:Spag17 APN 3 100072085 missense probably benign 0.09
IGL02751:Spag17 APN 3 100010794 nonsense probably null
IGL02803:Spag17 APN 3 100109397 missense probably benign
IGL02898:Spag17 APN 3 100101386 missense probably benign 0.00
IGL03037:Spag17 APN 3 100072170 splice site probably null
IGL03068:Spag17 APN 3 100080205 missense probably benign 0.35
IGL03131:Spag17 APN 3 100010759 missense possibly damaging 0.85
IGL03224:Spag17 APN 3 100010840 missense possibly damaging 0.53
FR4342:Spag17 UTSW 3 100056249 small insertion probably benign
FR4342:Spag17 UTSW 3 100056252 small insertion probably benign
FR4548:Spag17 UTSW 3 100056254 small insertion probably benign
FR4589:Spag17 UTSW 3 100056245 small insertion probably benign
FR4589:Spag17 UTSW 3 100056258 small insertion probably benign
FR4737:Spag17 UTSW 3 100056257 small insertion probably benign
FR4976:Spag17 UTSW 3 100056254 small insertion probably benign
FR4976:Spag17 UTSW 3 100056255 small insertion probably benign
N/A:Spag17 UTSW 3 99982254 splice site probably benign
PIT4504001:Spag17 UTSW 3 100103110 critical splice acceptor site probably null
PIT4514001:Spag17 UTSW 3 100013211 missense possibly damaging 0.53
R0107:Spag17 UTSW 3 100050787 missense possibly damaging 0.72
R0230:Spag17 UTSW 3 100106827 missense probably benign 0.08
R0243:Spag17 UTSW 3 100085368 missense probably benign 0.04
R0321:Spag17 UTSW 3 100101403 missense probably damaging 0.99
R0375:Spag17 UTSW 3 100027590 missense probably benign
R0417:Spag17 UTSW 3 100065554 missense probably benign 0.11
R0490:Spag17 UTSW 3 99982411 missense probably damaging 0.97
R0537:Spag17 UTSW 3 100125302 missense probably damaging 0.98
R0714:Spag17 UTSW 3 100080156 missense probably damaging 0.97
R0844:Spag17 UTSW 3 100004785 missense probably benign
R0919:Spag17 UTSW 3 100071943 splice site probably benign
R0926:Spag17 UTSW 3 100072116 missense probably benign
R1037:Spag17 UTSW 3 100103117 missense probably benign 0.01
R1075:Spag17 UTSW 3 100093676 missense probably damaging 0.99
R1109:Spag17 UTSW 3 100027351 missense possibly damaging 0.86
R1213:Spag17 UTSW 3 100095638 missense probably benign 0.01
R1221:Spag17 UTSW 3 99982268 missense possibly damaging 0.72
R1576:Spag17 UTSW 3 99939363 missense possibly damaging 0.73
R1586:Spag17 UTSW 3 100021752 missense possibly damaging 0.53
R1768:Spag17 UTSW 3 100027352 missense possibly damaging 0.53
R1782:Spag17 UTSW 3 100010754 missense probably benign 0.02
R1789:Spag17 UTSW 3 99939356 missense possibly damaging 0.73
R1945:Spag17 UTSW 3 99939982 missense probably benign
R2065:Spag17 UTSW 3 100013208 missense probably benign 0.03
R2118:Spag17 UTSW 3 100049240 missense possibly damaging 0.72
R2265:Spag17 UTSW 3 100061866 splice site probably null
R2266:Spag17 UTSW 3 100061866 splice site probably null
R2267:Spag17 UTSW 3 100061866 splice site probably null
R2268:Spag17 UTSW 3 100061866 splice site probably null
R2271:Spag17 UTSW 3 100106797 missense probably damaging 1.00
R2389:Spag17 UTSW 3 100106837 missense probably benign 0.27
R2420:Spag17 UTSW 3 100027619 missense probably benign
R2422:Spag17 UTSW 3 100027619 missense probably benign
R2423:Spag17 UTSW 3 100103456 missense probably benign
R3407:Spag17 UTSW 3 100085299 missense probably benign 0.09
R3801:Spag17 UTSW 3 100053853 missense possibly damaging 0.53
R3856:Spag17 UTSW 3 100106759 missense probably damaging 1.00
R4021:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4022:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4408:Spag17 UTSW 3 100103378 missense probably benign
R4468:Spag17 UTSW 3 100085366 missense probably damaging 0.98
R4540:Spag17 UTSW 3 100088381 missense probably damaging 1.00
R4621:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4622:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4756:Spag17 UTSW 3 100103385 missense possibly damaging 0.68
R4797:Spag17 UTSW 3 99984479 missense possibly damaging 0.70
R4855:Spag17 UTSW 3 100063333 missense probably benign 0.02
R4887:Spag17 UTSW 3 100050831 missense probably damaging 1.00
R4962:Spag17 UTSW 3 100027623 missense probably benign
R5030:Spag17 UTSW 3 100085341 nonsense probably null
R5042:Spag17 UTSW 3 100072149 missense probably damaging 1.00
R5074:Spag17 UTSW 3 100080118 missense possibly damaging 0.94
R5200:Spag17 UTSW 3 100063471 nonsense probably null
R5267:Spag17 UTSW 3 100061948 missense probably damaging 0.98
R5360:Spag17 UTSW 3 100109410 missense probably benign 0.00
R5444:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5498:Spag17 UTSW 3 100103345 missense possibly damaging 0.83
R5503:Spag17 UTSW 3 100027244 missense possibly damaging 0.72
R5540:Spag17 UTSW 3 100056272 missense possibly damaging 0.91
R5547:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5575:Spag17 UTSW 3 100053822 missense possibly damaging 0.85
R5629:Spag17 UTSW 3 100080119 missense probably benign 0.33
R5639:Spag17 UTSW 3 100056166 missense probably damaging 1.00
R5842:Spag17 UTSW 3 99939250 missense possibly damaging 0.85
R5976:Spag17 UTSW 3 100095791 nonsense probably null
R6082:Spag17 UTSW 3 100124185 missense possibly damaging 0.46
R6228:Spag17 UTSW 3 100022602 missense probably benign 0.33
R6254:Spag17 UTSW 3 100065585 missense probably benign 0.03
R6321:Spag17 UTSW 3 100088427 missense probably benign 0.05
R6446:Spag17 UTSW 3 100103132 missense probably benign
R6687:Spag17 UTSW 3 100092950 missense probably benign 0.07
R6853:Spag17 UTSW 3 100013235 missense possibly damaging 0.86
R6946:Spag17 UTSW 3 100004683 missense possibly damaging 0.53
R6953:Spag17 UTSW 3 100034975 missense possibly damaging 0.53
R7038:Spag17 UTSW 3 99984609 missense probably benign 0.00
R7084:Spag17 UTSW 3 99939270 missense probably benign 0.18
R7126:Spag17 UTSW 3 100101435 missense probably benign 0.00
R7144:Spag17 UTSW 3 100027401 splice site probably null
R7198:Spag17 UTSW 3 100095572 missense probably benign 0.02
R7318:Spag17 UTSW 3 99939983 missense probably benign 0.00
R7403:Spag17 UTSW 3 99939375 missense possibly damaging 0.53
R7409:Spag17 UTSW 3 100027231 missense possibly damaging 0.73
R7409:Spag17 UTSW 3 100034159 missense probably benign 0.00
R7537:Spag17 UTSW 3 99939247 missense possibly damaging 0.96
R7609:Spag17 UTSW 3 100095595 nonsense probably null
X0025:Spag17 UTSW 3 100101451 missense probably benign 0.31
Z1088:Spag17 UTSW 3 100095630 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCCCTGGAGTTCTTGAAAATTCAG -3'
(R):5'- ACCAGCTACATCTGAAGGGG -3'

Sequencing Primer
(F):5'- CTGGAGTTCTTGAAAATTCAGGATAC -3'
(R):5'- CTACATCTGAAGGGGCTGTATTGAC -3'
Posted On2016-07-06