Incidental Mutation 'R0456:Sult1e1'
ID40006
Institutional Source Beutler Lab
Gene Symbol Sult1e1
Ensembl Gene ENSMUSG00000029272
Gene Namesulfotransferase family 1E, member 1
SynonymsEST, Ste
MMRRC Submission 038656-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R0456 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location87575969-87591594 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87578634 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 207 (L207P)
Ref Sequence ENSEMBL: ENSMUSP00000031201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031201]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031201
AA Change: L207P

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031201
Gene: ENSMUSG00000029272
AA Change: L207P

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 38 288 1.1e-91 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a protein that transfers a sulfo moiety to and from estrone, which may control levels of estrogen receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit reduced fertility. Males exhibit abnormal testis morphology with Leydig cell hypertrophy and hyperplasia and reduced caudal sperm motility. Spontaneous fetal loss caused by placental thrombosis occurs in pregnant females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 G A 18: 12,295,979 P11L probably damaging Het
Antxr1 A C 6: 87,217,275 V347G probably damaging Het
Atp13a5 T C 16: 29,232,740 N1127D probably benign Het
Bivm T A 1: 44,126,809 W140R probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Ceacam5 T C 7: 17,760,851 V928A possibly damaging Het
Chia1 T C 3: 106,128,479 Y152H probably damaging Het
Chsy3 A T 18: 59,176,478 I268F probably damaging Het
CK137956 A T 4: 127,945,307 N439K probably damaging Het
Csf3r C A 4: 126,035,861 N392K probably damaging Het
Cyp1b1 T C 17: 79,710,275 I484V probably benign Het
Dsc1 T C 18: 20,099,112 K280E probably damaging Het
Eefsec A G 6: 88,297,888 Y365H probably benign Het
Epb41l4b C T 4: 57,142,843 probably null Het
Erap1 G A 13: 74,664,220 V385I probably benign Het
Fat1 A T 8: 45,029,534 I3077F probably damaging Het
Fras1 G T 5: 96,554,788 G230C probably damaging Het
Fras1 T G 5: 96,714,343 probably null Het
Gsg1l A G 7: 125,923,510 M182T possibly damaging Het
Gzmg A G 14: 56,158,322 V60A probably damaging Het
Hapln4 A T 8: 70,084,995 Y113F probably benign Het
Hist1h4f T C 13: 23,551,387 D86G probably damaging Het
Ikzf4 T A 10: 128,635,808 T274S probably damaging Het
Kansl1l T A 1: 66,735,726 H302L probably damaging Het
Klhl41 T C 2: 69,670,549 V118A probably damaging Het
Kpna1 T C 16: 36,002,900 S41P possibly damaging Het
Krt23 A G 11: 99,486,778 V134A probably benign Het
Lamb1 G A 12: 31,304,730 C992Y probably damaging Het
Lrif1 C T 3: 106,731,778 P35S probably benign Het
Lrrc4 A G 6: 28,831,104 S171P probably damaging Het
Lvrn G A 18: 46,864,816 probably null Het
Matr3 T A 18: 35,572,864 F281I probably damaging Het
Nxn G A 11: 76,263,137 Q291* probably null Het
Olfr1467 A G 19: 13,364,738 T37A probably damaging Het
Pdp2 G T 8: 104,593,789 R90L probably damaging Het
Ppp1r3c C A 19: 36,733,891 E160* probably null Het
Ppp2r5c T G 12: 110,522,579 S118R probably damaging Het
Ptpn23 G T 9: 110,389,793 probably null Het
Ptpro G T 6: 137,414,230 V783L probably benign Het
Rab40c A G 17: 25,884,657 V144A possibly damaging Het
Rasal2 T C 1: 157,149,843 N1087S probably damaging Het
Rfc3 T A 5: 151,647,523 S103C possibly damaging Het
Rgl2 A G 17: 33,936,849 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rit2 A T 18: 30,975,451 F160L probably benign Het
Rnh1 A G 7: 141,162,548 S366P possibly damaging Het
Sdk2 T C 11: 113,791,466 Y2029C possibly damaging Het
Smpd3 T A 8: 106,259,656 I505F probably benign Het
Sorcs3 A T 19: 48,654,044 S379C possibly damaging Het
Sycp2 C G 2: 178,381,855 S456T probably benign Het
Syne1 T C 10: 5,342,252 T1339A probably benign Het
Tas2r117 A G 6: 132,803,391 N164S probably benign Het
Tigd3 A G 19: 5,892,793 L103P probably damaging Het
Tldc1 A T 8: 119,768,423 F199I probably damaging Het
Tmem132b T C 5: 125,787,724 S965P probably damaging Het
Tmem82 T C 4: 141,617,390 T81A probably benign Het
Tmem8b A G 4: 43,685,618 T156A probably benign Het
Tnfrsf21 A G 17: 43,038,091 E198G probably benign Het
Tnpo2 A G 8: 85,054,416 N767S probably damaging Het
Trf T C 9: 103,226,903 Y87C probably damaging Het
Tst A G 15: 78,405,580 V85A probably damaging Het
Usp37 A T 1: 74,468,348 N503K probably damaging Het
Utp20 C T 10: 88,754,573 M2346I possibly damaging Het
Vax2 A G 6: 83,711,406 D37G probably benign Het
Vmn1r77 T A 7: 12,041,738 L79* probably null Het
Zbtb3 A T 19: 8,803,200 D59V probably damaging Het
Zdhhc13 T C 7: 48,808,854 F182S probably benign Het
Zfp426 A G 9: 20,470,297 F465L probably damaging Het
Zfp526 A G 7: 25,226,212 E632G probably damaging Het
Other mutations in Sult1e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01504:Sult1e1 APN 5 87576301 missense probably damaging 1.00
IGL01588:Sult1e1 APN 5 87576243 missense probably benign 0.01
IGL02685:Sult1e1 APN 5 87579906 nonsense probably null
IGL03083:Sult1e1 APN 5 87590124 missense probably benign
IGL03137:Sult1e1 APN 5 87578616 missense probably benign 0.00
IGL03217:Sult1e1 APN 5 87590088 missense possibly damaging 0.46
R0069:Sult1e1 UTSW 5 87579897 missense probably damaging 1.00
R0069:Sult1e1 UTSW 5 87579897 missense probably damaging 1.00
R1446:Sult1e1 UTSW 5 87578537 missense probably damaging 1.00
R1953:Sult1e1 UTSW 5 87587671 critical splice acceptor site probably null
R2697:Sult1e1 UTSW 5 87578538 missense probably damaging 1.00
R4791:Sult1e1 UTSW 5 87586730 missense possibly damaging 0.61
R4799:Sult1e1 UTSW 5 87590168 missense possibly damaging 0.70
R5103:Sult1e1 UTSW 5 87576232 missense probably benign
R5158:Sult1e1 UTSW 5 87587594 missense probably damaging 1.00
R5219:Sult1e1 UTSW 5 87578586 missense probably damaging 0.98
R6148:Sult1e1 UTSW 5 87579911 missense probably damaging 1.00
R6530:Sult1e1 UTSW 5 87576288 missense probably benign 0.18
R6866:Sult1e1 UTSW 5 87586766 missense probably damaging 1.00
R7295:Sult1e1 UTSW 5 87578653 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGCTGATGCTGAGACCAAGGTG -3'
(R):5'- AACAGCTTCTGAAGTGTCTCCTGC -3'

Sequencing Primer
(F):5'- GACCAAGGTGTCTGACATTATGC -3'
(R):5'- TTGGATGACAAAGGATTGCTTG -3'
Posted On2013-05-23