Incidental Mutation 'R5195:Pramel5'
ID 400071
Institutional Source Beutler Lab
Gene Symbol Pramel5
Ensembl Gene ENSMUSG00000036749
Gene Name PRAME like 5
Synonyms OTTMUSG00000010540
MMRRC Submission 042771-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.129) question?
Stock # R5195 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 143997203-144007036 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 143998311 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 311 (M311L)
Ref Sequence ENSEMBL: ENSMUSP00000101378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035757] [ENSMUST00000105752]
AlphaFold Q7TPY4
Predicted Effect probably benign
Transcript: ENSMUST00000035757
AA Change: M311L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000044222
Gene: ENSMUSG00000036749
AA Change: M311L

DomainStartEndE-ValueType
SCOP:d1a4ya_ 224 411 1e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105752
AA Change: M311L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000101378
Gene: ENSMUSG00000036749
AA Change: M311L

DomainStartEndE-ValueType
SCOP:d1a4ya_ 224 411 1e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144127
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (72/74)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apoo-ps T C 13: 107,551,053 (GRCm39) noncoding transcript Het
Arhgef40 T A 14: 52,227,269 (GRCm39) S438T possibly damaging Het
Barhl2 A G 5: 106,601,305 (GRCm39) L358P possibly damaging Het
Bicra G A 7: 15,713,878 (GRCm39) P775S possibly damaging Het
Ccdc78 T A 17: 26,008,962 (GRCm39) probably null Het
Ccnb1-ps T A 7: 41,755,522 (GRCm39) noncoding transcript Het
Cct6a A T 5: 129,871,718 (GRCm39) noncoding transcript Het
Cep120 T A 18: 53,854,770 (GRCm39) H455L probably damaging Het
Cobl C T 11: 12,203,565 (GRCm39) V964I probably benign Het
Cpt1a A T 19: 3,433,800 (GRCm39) I761F possibly damaging Het
Crk T A 11: 75,570,289 (GRCm39) Y14N probably damaging Het
Deup1 A T 9: 15,486,487 (GRCm39) Y398N possibly damaging Het
Efcab15 T C 11: 103,089,794 (GRCm39) Y381C probably damaging Het
Epha3 C T 16: 63,366,510 (GRCm39) G980D possibly damaging Het
Fanca A G 8: 124,030,684 (GRCm39) probably benign Het
Gbp4 T A 5: 105,267,398 (GRCm39) D507V probably benign Het
Gtf2i A T 5: 134,273,686 (GRCm39) L740* probably null Het
Hmgn2 C A 4: 133,694,597 (GRCm39) A8S probably benign Het
Hook2 A T 8: 85,721,405 (GRCm39) N252I probably damaging Het
Igkv19-93 T A 6: 68,713,510 (GRCm39) T39S probably damaging Het
Inpp5j A C 11: 3,449,889 (GRCm39) probably null Het
Insyn2a A T 7: 134,486,145 (GRCm39) F469I probably damaging Het
Kbtbd3 G C 9: 4,316,905 (GRCm39) E19Q possibly damaging Het
Kcns2 G A 15: 34,839,677 (GRCm39) A347T possibly damaging Het
Klhl31 A G 9: 77,557,572 (GRCm39) E96G possibly damaging Het
Kptn A G 7: 15,857,028 (GRCm39) Y172C probably damaging Het
Krt86 T A 15: 101,374,814 (GRCm39) M328K probably benign Het
Lama1 A G 17: 68,071,795 (GRCm39) D894G probably benign Het
Lars2 T C 9: 123,282,375 (GRCm39) V653A probably damaging Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Lhcgr A T 17: 89,050,374 (GRCm39) V384D probably damaging Het
Malrd1 C T 2: 16,155,621 (GRCm39) T2010M unknown Het
Maml2 T A 9: 13,532,410 (GRCm39) N541K probably damaging Het
Med24 T C 11: 98,601,107 (GRCm39) K585R possibly damaging Het
Muc20 G A 16: 32,614,846 (GRCm39) S177L unknown Het
Mylk T A 16: 34,799,585 (GRCm39) F1658L probably damaging Het
Obscn C T 11: 58,951,676 (GRCm39) V4392I possibly damaging Het
Or10d5 A G 9: 39,861,975 (GRCm39) S31P probably benign Het
Or11g2 T C 14: 50,856,243 (GRCm39) L188P probably damaging Het
Pcnx2 A T 8: 126,528,288 (GRCm39) F1311I possibly damaging Het
Pcsk1 T C 13: 75,274,974 (GRCm39) L521P probably damaging Het
Pde4a A G 9: 21,115,629 (GRCm39) T445A possibly damaging Het
Pgam5 A T 5: 110,413,854 (GRCm39) L103* probably null Het
Pkd2 G A 5: 104,634,547 (GRCm39) R526Q probably benign Het
Polr2a T C 11: 69,634,905 (GRCm39) Y618C probably damaging Het
Pramel16 T A 4: 143,677,450 (GRCm39) E43V probably damaging Het
Rbbp8 T C 18: 11,855,208 (GRCm39) F478L probably benign Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Ryk T C 9: 102,744,812 (GRCm39) V122A probably benign Het
Sik3 G T 9: 46,120,142 (GRCm39) probably null Het
Slc22a30 G A 19: 8,321,757 (GRCm39) Q436* probably null Het
Slc35e4 T A 11: 3,862,872 (GRCm39) I106F possibly damaging Het
Slc41a3 T C 6: 90,610,653 (GRCm39) S172P probably damaging Het
Snrnp70 T A 7: 45,044,134 (GRCm39) K32N probably damaging Het
Spag17 T C 3: 100,008,704 (GRCm39) Y1945H probably benign Het
St7 A G 6: 17,743,636 (GRCm39) probably benign Het
Stab1 C A 14: 30,862,478 (GRCm39) probably benign Het
Taf13 G A 3: 108,488,390 (GRCm39) R91Q probably damaging Het
Tmem200a T C 10: 25,954,854 (GRCm39) probably benign Het
Tnc A T 4: 63,885,489 (GRCm39) L1871Q probably damaging Het
Toe1 T C 4: 116,661,852 (GRCm39) H439R probably damaging Het
Trpm1 T C 7: 63,887,441 (GRCm39) V893A possibly damaging Het
Ubr3 G A 2: 69,786,378 (GRCm39) A831T probably benign Het
Wdr89 C T 12: 75,680,062 (GRCm39) R64Q probably benign Het
Zbed5 G T 5: 129,931,019 (GRCm39) V323F probably benign Het
Zeb2 T C 2: 44,891,647 (GRCm39) R287G probably damaging Het
Other mutations in Pramel5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Pramel5 APN 4 143,998,191 (GRCm39) missense probably damaging 1.00
IGL00990:Pramel5 APN 4 144,000,549 (GRCm39) missense probably damaging 1.00
IGL01070:Pramel5 APN 4 143,997,842 (GRCm39) missense probably damaging 1.00
IGL01298:Pramel5 APN 4 143,997,732 (GRCm39) utr 3 prime probably benign
IGL01653:Pramel5 APN 4 144,000,429 (GRCm39) missense probably benign 0.01
IGL02150:Pramel5 APN 4 143,999,771 (GRCm39) missense possibly damaging 0.93
IGL02278:Pramel5 APN 4 143,998,121 (GRCm39) missense probably damaging 1.00
IGL02671:Pramel5 APN 4 143,999,682 (GRCm39) missense probably benign 0.25
IGL02868:Pramel5 APN 4 143,997,922 (GRCm39) missense probably benign 0.03
IGL02981:Pramel5 APN 4 143,999,430 (GRCm39) missense probably benign 0.01
R0532:Pramel5 UTSW 4 143,999,310 (GRCm39) missense probably benign 0.03
R0646:Pramel5 UTSW 4 143,998,190 (GRCm39) missense probably damaging 1.00
R1328:Pramel5 UTSW 4 143,998,058 (GRCm39) missense probably damaging 1.00
R1902:Pramel5 UTSW 4 144,000,433 (GRCm39) nonsense probably null
R2027:Pramel5 UTSW 4 143,998,274 (GRCm39) missense probably damaging 1.00
R2240:Pramel5 UTSW 4 143,999,506 (GRCm39) nonsense probably null
R2439:Pramel5 UTSW 4 144,000,310 (GRCm39) missense probably benign 0.01
R3922:Pramel5 UTSW 4 143,999,622 (GRCm39) missense probably damaging 1.00
R4470:Pramel5 UTSW 4 143,997,915 (GRCm39) missense possibly damaging 0.89
R4808:Pramel5 UTSW 4 143,999,325 (GRCm39) missense probably benign 0.04
R4969:Pramel5 UTSW 4 143,998,187 (GRCm39) missense probably damaging 1.00
R5198:Pramel5 UTSW 4 144,000,064 (GRCm39) intron probably benign
R5930:Pramel5 UTSW 4 143,999,553 (GRCm39) missense probably benign 0.43
R5988:Pramel5 UTSW 4 143,999,716 (GRCm39) missense possibly damaging 0.46
R6662:Pramel5 UTSW 4 143,999,675 (GRCm39) missense probably benign 0.32
R6988:Pramel5 UTSW 4 144,000,577 (GRCm39) start gained probably benign
R7116:Pramel5 UTSW 4 144,000,451 (GRCm39) missense possibly damaging 0.94
R7638:Pramel5 UTSW 4 143,998,010 (GRCm39) missense possibly damaging 0.93
R8247:Pramel5 UTSW 4 143,999,395 (GRCm39) missense probably damaging 1.00
R8993:Pramel5 UTSW 4 143,999,529 (GRCm39) missense possibly damaging 0.81
R9049:Pramel5 UTSW 4 144,000,486 (GRCm39) missense probably benign 0.02
R9402:Pramel5 UTSW 4 143,998,026 (GRCm39) missense probably benign 0.15
R9632:Pramel5 UTSW 4 143,999,545 (GRCm39) missense probably benign 0.15
R9710:Pramel5 UTSW 4 143,999,545 (GRCm39) missense probably benign 0.15
X0028:Pramel5 UTSW 4 143,999,406 (GRCm39) missense probably benign 0.00
Z1176:Pramel5 UTSW 4 144,000,430 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGAAGGTCACGGATTTGG -3'
(R):5'- TTGGCTAAGGAAACTCTGCTAC -3'

Sequencing Primer
(F):5'- AGGTCACGGATTTGGAAGTCC -3'
(R):5'- CTCTGCTACTTTGAAATAACAGCC -3'
Posted On 2016-07-06