Incidental Mutation 'R5195:Pkd2'
ID400074
Institutional Source Beutler Lab
Gene Symbol Pkd2
Ensembl Gene ENSMUSG00000034462
Gene Namepolycystic kidney disease 2
SynonymsC030034P18Rik, TRPP2, polycystin-2, PC2
MMRRC Submission 042771-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5195 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location104459450-104505819 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 104486681 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 526 (R526Q)
Ref Sequence ENSEMBL: ENSMUSP00000084041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086831]
Predicted Effect probably benign
Transcript: ENSMUST00000086831
AA Change: R526Q

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000084041
Gene: ENSMUSG00000034462
AA Change: R526Q

DomainStartEndE-ValueType
low complexity region 25 43 N/A INTRINSIC
low complexity region 58 79 N/A INTRINSIC
low complexity region 93 115 N/A INTRINSIC
low complexity region 119 138 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
Pfam:PKD_channel 265 685 1.3e-171 PFAM
Pfam:Ion_trans 454 690 2.6e-25 PFAM
coiled coil region 765 794 N/A INTRINSIC
PDB:3HRN|A 834 893 8e-31 PDB
low complexity region 900 915 N/A INTRINSIC
low complexity region 949 963 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130931
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein is a multi-pass membrane protein that functions as a calcium permeable cation channel, and is involved in calcium transport and calcium signaling in renal epithelial cells. This protein interacts with polycystin 1, and they may be partners in a common signaling cascade involved in tubular morphogenesis. Mutations in this gene are associated with autosomal dominant polycystic kidney disease type 2. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in cardiac septation, kidney and pancreatic cysts, impaired left-right axis determination, and late-gestation lethality. Heterozygotes show kidney and liver lesions and have reduced longevity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,198,968 Y381C probably damaging Het
Apoo-ps T C 13: 107,414,553 noncoding transcript Het
Arhgef40 T A 14: 51,989,812 S438T possibly damaging Het
Barhl2 A G 5: 106,453,439 L358P possibly damaging Het
Bicra G A 7: 15,979,953 P775S possibly damaging Het
Ccdc78 T A 17: 25,789,988 probably null Het
Ccnb1-ps T A 7: 42,106,098 noncoding transcript Het
Cct6a A T 5: 129,794,655 noncoding transcript Het
Cep120 T A 18: 53,721,698 H455L probably damaging Het
Cobl C T 11: 12,253,565 V964I probably benign Het
Cpt1a A T 19: 3,383,800 I761F possibly damaging Het
Crk T A 11: 75,679,463 Y14N probably damaging Het
Deup1 A T 9: 15,575,191 Y398N possibly damaging Het
Epha3 C T 16: 63,546,147 G980D possibly damaging Het
Fam196a A T 7: 134,884,416 F469I probably damaging Het
Fanca A G 8: 123,303,945 probably benign Het
Gbp4 T A 5: 105,119,532 D507V probably benign Het
Gtf2i A T 5: 134,244,832 L740* probably null Het
Hmgn2 C A 4: 133,967,286 A8S probably benign Het
Hook2 A T 8: 84,994,776 N252I probably damaging Het
Igkv19-93 T A 6: 68,736,526 T39S probably damaging Het
Inpp5j A C 11: 3,499,889 probably null Het
Kbtbd3 G C 9: 4,316,905 E19Q possibly damaging Het
Kcns2 G A 15: 34,839,531 A347T possibly damaging Het
Klhl31 A G 9: 77,650,290 E96G possibly damaging Het
Kptn A G 7: 16,123,103 Y172C probably damaging Het
Krt86 T A 15: 101,476,933 M328K probably benign Het
Lama1 A G 17: 67,764,800 D894G probably benign Het
Lars2 T C 9: 123,453,310 V653A probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lhcgr A T 17: 88,742,946 V384D probably damaging Het
Malrd1 C T 2: 16,150,810 T2010M unknown Het
Maml2 T A 9: 13,621,114 N541K probably damaging Het
Med24 T C 11: 98,710,281 K585R possibly damaging Het
Muc20 G A 16: 32,794,476 S177L unknown Het
Mylk T A 16: 34,979,215 F1658L probably damaging Het
Obscn C T 11: 59,060,850 V4392I possibly damaging Het
Olfr744 T C 14: 50,618,786 L188P probably damaging Het
Olfr975 A G 9: 39,950,679 S31P probably benign Het
Pcnx2 A T 8: 125,801,549 F1311I possibly damaging Het
Pcsk1 T C 13: 75,126,855 L521P probably damaging Het
Pde4a A G 9: 21,204,333 T445A possibly damaging Het
Pgam5 A T 5: 110,265,988 L103* probably null Het
Polr2a T C 11: 69,744,079 Y618C probably damaging Het
Pramef25 T A 4: 143,950,880 E43V probably damaging Het
Pramel5 T A 4: 144,271,741 M311L probably benign Het
Rbbp8 T C 18: 11,722,151 F478L probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryk T C 9: 102,867,613 V122A probably benign Het
Sik3 G T 9: 46,208,844 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc35e4 T A 11: 3,912,872 I106F possibly damaging Het
Slc41a3 T C 6: 90,633,671 S172P probably damaging Het
Snrnp70 T A 7: 45,394,710 K32N probably damaging Het
Spag17 T C 3: 100,101,388 Y1945H probably benign Het
St7 A G 6: 17,743,637 probably benign Het
Stab1 C A 14: 31,140,521 probably benign Het
Taf13 G A 3: 108,581,074 R91Q probably damaging Het
Tmem200a T C 10: 26,078,956 probably benign Het
Tnc A T 4: 63,967,252 L1871Q probably damaging Het
Toe1 T C 4: 116,804,655 H439R probably damaging Het
Trpm1 T C 7: 64,237,693 V893A possibly damaging Het
Ubr3 G A 2: 69,956,034 A831T probably benign Het
Wdr89 C T 12: 75,633,288 R64Q probably benign Het
Zbed5 G T 5: 129,902,178 V323F probably benign Het
Zeb2 T C 2: 45,001,635 R287G probably damaging Het
Other mutations in Pkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Pkd2 APN 5 104483135 missense probably damaging 1.00
IGL01527:Pkd2 APN 5 104498884 splice site probably benign
IGL01805:Pkd2 APN 5 104483093 missense probably benign 0.41
IGL02146:Pkd2 APN 5 104489291 missense probably damaging 1.00
IGL02326:Pkd2 APN 5 104477075 missense probably benign 0.38
IGL02481:Pkd2 APN 5 104486770 missense probably damaging 1.00
IGL02952:Pkd2 APN 5 104480160 missense possibly damaging 0.48
IGL03026:Pkd2 APN 5 104494887 splice site probably benign
IGL03409:Pkd2 APN 5 104489349 nonsense probably null
Nephro UTSW 5 104486806 missense probably damaging 1.00
reggae UTSW 5 104477179 splice site probably null
samba UTSW 5 104477123 missense probably benign 0.01
IGL02988:Pkd2 UTSW 5 104503605 nonsense probably null
PIT1430001:Pkd2 UTSW 5 104459788 missense probably damaging 0.99
R0020:Pkd2 UTSW 5 104503516 missense probably damaging 1.00
R0020:Pkd2 UTSW 5 104503516 missense probably damaging 1.00
R0045:Pkd2 UTSW 5 104455805 unclassified probably benign
R0070:Pkd2 UTSW 5 104466990 missense probably damaging 0.99
R0070:Pkd2 UTSW 5 104466990 missense probably damaging 0.99
R0315:Pkd2 UTSW 5 104459850 missense possibly damaging 0.94
R0316:Pkd2 UTSW 5 104477166 missense probably damaging 1.00
R0570:Pkd2 UTSW 5 104455605 unclassified probably benign
R1277:Pkd2 UTSW 5 104502359 missense probably damaging 0.97
R1883:Pkd2 UTSW 5 104483228 missense probably damaging 1.00
R1907:Pkd2 UTSW 5 104486806 missense probably damaging 1.00
R1937:Pkd2 UTSW 5 104478924 missense probably damaging 1.00
R2023:Pkd2 UTSW 5 104466878 splice site probably null
R2080:Pkd2 UTSW 5 104477123 missense probably benign 0.01
R2081:Pkd2 UTSW 5 104460211 missense probably benign 0.00
R2098:Pkd2 UTSW 5 104478902 missense probably damaging 1.00
R2117:Pkd2 UTSW 5 104483176 missense probably damaging 1.00
R2146:Pkd2 UTSW 5 104455590 unclassified probably benign
R2163:Pkd2 UTSW 5 104455677 unclassified probably benign
R3401:Pkd2 UTSW 5 104480327 missense possibly damaging 0.68
R3732:Pkd2 UTSW 5 104489419 splice site probably null
R3733:Pkd2 UTSW 5 104489419 splice site probably null
R4409:Pkd2 UTSW 5 104466884 splice site silent
R4582:Pkd2 UTSW 5 104502344 nonsense probably null
R5189:Pkd2 UTSW 5 104459919 missense probably benign 0.22
R5191:Pkd2 UTSW 5 104486681 missense probably benign 0.05
R5198:Pkd2 UTSW 5 104483092 missense probably benign 0.06
R5326:Pkd2 UTSW 5 104486649 splice site silent
R5406:Pkd2 UTSW 5 104480332 missense probably damaging 1.00
R5542:Pkd2 UTSW 5 104486649 splice site silent
R5543:Pkd2 UTSW 5 104489333 missense probably damaging 1.00
R5633:Pkd2 UTSW 5 104498506 missense probably damaging 0.98
R5887:Pkd2 UTSW 5 104498539 missense probably damaging 1.00
R5906:Pkd2 UTSW 5 104477179 splice site probably null
R5924:Pkd2 UTSW 5 104498558 missense probably damaging 0.99
R6361:Pkd2 UTSW 5 104486680 nonsense probably null
R6455:Pkd2 UTSW 5 104459924 missense probably benign 0.00
R6495:Pkd2 UTSW 5 104489293 missense probably damaging 1.00
R6735:Pkd2 UTSW 5 104480329 missense probably damaging 1.00
R6837:Pkd2 UTSW 5 104477043 missense probably damaging 1.00
R7192:Pkd2 UTSW 5 104486657 missense probably benign 0.00
R7477:Pkd2 UTSW 5 104483242 missense probably benign 0.19
R7560:Pkd2 UTSW 5 104480353 missense probably damaging 1.00
Z1088:Pkd2 UTSW 5 104498861 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGCACATTTAGAGCTGATGGC -3'
(R):5'- CATCTGGCCATTTCAATCAGCC -3'

Sequencing Primer
(F):5'- CTGATGTTGGCTCAGTAATATGGTC -3'
(R):5'- TGGCCATTTCAATCAGCCTAAAAAGG -3'
Posted On2016-07-06