Incidental Mutation 'R0456:Tmem132b'
ID 40009
Institutional Source Beutler Lab
Gene Symbol Tmem132b
Ensembl Gene ENSMUSG00000070498
Gene Name transmembrane protein 132B
Synonyms
MMRRC Submission 038656-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R0456 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 125609449-125869647 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 125864788 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 965 (S965P)
Ref Sequence ENSEMBL: ENSMUSP00000031446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031446]
AlphaFold F7BAB2
Predicted Effect probably damaging
Transcript: ENSMUST00000031446
AA Change: S965P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031446
Gene: ENSMUSG00000070498
AA Change: S965P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TMEM132D_N 44 173 2.9e-53 PFAM
Pfam:TMEM132 432 774 5.9e-145 PFAM
Pfam:TMEM132D_C 870 953 1.3e-36 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 G A 18: 12,429,036 (GRCm39) P11L probably damaging Het
Antxr1 A C 6: 87,194,257 (GRCm39) V347G probably damaging Het
Atp13a5 T C 16: 29,051,492 (GRCm39) N1127D probably benign Het
Bivm T A 1: 44,165,969 (GRCm39) W140R probably damaging Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Ceacam5 T C 7: 17,494,776 (GRCm39) V928A possibly damaging Het
Chia1 T C 3: 106,035,795 (GRCm39) Y152H probably damaging Het
Chsy3 A T 18: 59,309,550 (GRCm39) I268F probably damaging Het
CK137956 A T 4: 127,839,100 (GRCm39) N439K probably damaging Het
Csf3r C A 4: 125,929,654 (GRCm39) N392K probably damaging Het
Cyp1b1 T C 17: 80,017,704 (GRCm39) I484V probably benign Het
Dsc1 T C 18: 20,232,169 (GRCm39) K280E probably damaging Het
Eefsec A G 6: 88,274,870 (GRCm39) Y365H probably benign Het
Epb41l4b C T 4: 57,142,843 (GRCm39) probably null Het
Erap1 G A 13: 74,812,339 (GRCm39) V385I probably benign Het
Fat1 A T 8: 45,482,571 (GRCm39) I3077F probably damaging Het
Fras1 T G 5: 96,862,202 (GRCm39) probably null Het
Fras1 G T 5: 96,702,647 (GRCm39) G230C probably damaging Het
Gsg1l A G 7: 125,522,682 (GRCm39) M182T possibly damaging Het
Gzmg A G 14: 56,395,779 (GRCm39) V60A probably damaging Het
H4c6 T C 13: 23,735,561 (GRCm39) D86G probably damaging Het
Hapln4 A T 8: 70,537,645 (GRCm39) Y113F probably benign Het
Ikzf4 T A 10: 128,471,677 (GRCm39) T274S probably damaging Het
Kansl1l T A 1: 66,774,885 (GRCm39) H302L probably damaging Het
Klhl41 T C 2: 69,500,893 (GRCm39) V118A probably damaging Het
Kpna1 T C 16: 35,823,270 (GRCm39) S41P possibly damaging Het
Krt23 A G 11: 99,377,604 (GRCm39) V134A probably benign Het
Lamb1 G A 12: 31,354,729 (GRCm39) C992Y probably damaging Het
Lrif1 C T 3: 106,639,094 (GRCm39) P35S probably benign Het
Lrrc4 A G 6: 28,831,103 (GRCm39) S171P probably damaging Het
Lvrn G A 18: 46,997,883 (GRCm39) probably null Het
Matr3 T A 18: 35,705,917 (GRCm39) F281I probably damaging Het
Meak7 A T 8: 120,495,162 (GRCm39) F199I probably damaging Het
Nxn G A 11: 76,153,963 (GRCm39) Q291* probably null Het
Or5b113 A G 19: 13,342,102 (GRCm39) T37A probably damaging Het
Pdp2 G T 8: 105,320,421 (GRCm39) R90L probably damaging Het
Ppp1r3c C A 19: 36,711,291 (GRCm39) E160* probably null Het
Ppp2r5c T G 12: 110,489,013 (GRCm39) S118R probably damaging Het
Ptpn23 G T 9: 110,218,861 (GRCm39) probably null Het
Ptpro G T 6: 137,391,228 (GRCm39) V783L probably benign Het
Rab40c A G 17: 26,103,631 (GRCm39) V144A possibly damaging Het
Rasal2 T C 1: 156,977,413 (GRCm39) N1087S probably damaging Het
Rfc3 T A 5: 151,570,988 (GRCm39) S103C possibly damaging Het
Rgl2 A G 17: 34,155,823 (GRCm39) probably null Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rit2 A T 18: 31,108,504 (GRCm39) F160L probably benign Het
Rnh1 A G 7: 140,742,461 (GRCm39) S366P possibly damaging Het
Sdk2 T C 11: 113,682,292 (GRCm39) Y2029C possibly damaging Het
Smpd3 T A 8: 106,986,288 (GRCm39) I505F probably benign Het
Sorcs3 A T 19: 48,642,483 (GRCm39) S379C possibly damaging Het
Sult1e1 A G 5: 87,726,493 (GRCm39) L207P possibly damaging Het
Sycp2 C G 2: 178,023,648 (GRCm39) S456T probably benign Het
Syne1 T C 10: 5,292,252 (GRCm39) T1339A probably benign Het
Tas2r117 A G 6: 132,780,354 (GRCm39) N164S probably benign Het
Tigd3 A G 19: 5,942,821 (GRCm39) L103P probably damaging Het
Tmem82 T C 4: 141,344,701 (GRCm39) T81A probably benign Het
Tmem8b A G 4: 43,685,618 (GRCm39) T156A probably benign Het
Tnfrsf21 A G 17: 43,348,982 (GRCm39) E198G probably benign Het
Tnpo2 A G 8: 85,781,045 (GRCm39) N767S probably damaging Het
Trf T C 9: 103,104,102 (GRCm39) Y87C probably damaging Het
Tst A G 15: 78,289,780 (GRCm39) V85A probably damaging Het
Usp37 A T 1: 74,507,507 (GRCm39) N503K probably damaging Het
Utp20 C T 10: 88,590,435 (GRCm39) M2346I possibly damaging Het
Vax2 A G 6: 83,688,388 (GRCm39) D37G probably benign Het
Vmn1r77 T A 7: 11,775,665 (GRCm39) L79* probably null Het
Zbtb3 A T 19: 8,780,564 (GRCm39) D59V probably damaging Het
Zdhhc13 T C 7: 48,458,602 (GRCm39) F182S probably benign Het
Zfp426 A G 9: 20,381,593 (GRCm39) F465L probably damaging Het
Zfp526 A G 7: 24,925,637 (GRCm39) E632G probably damaging Het
Other mutations in Tmem132b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Tmem132b APN 5 125,775,792 (GRCm39) missense probably benign
IGL01518:Tmem132b APN 5 125,855,855 (GRCm39) missense probably damaging 1.00
IGL02542:Tmem132b APN 5 125,699,558 (GRCm39) missense probably damaging 1.00
IGL02652:Tmem132b APN 5 125,864,639 (GRCm39) missense probably damaging 1.00
IGL02671:Tmem132b APN 5 125,855,791 (GRCm39) missense probably damaging 0.97
IGL02951:Tmem132b APN 5 125,864,611 (GRCm39) missense probably damaging 0.99
R0462:Tmem132b UTSW 5 125,862,990 (GRCm39) missense probably damaging 1.00
R0724:Tmem132b UTSW 5 125,860,485 (GRCm39) missense possibly damaging 0.95
R1137:Tmem132b UTSW 5 125,860,606 (GRCm39) missense possibly damaging 0.94
R1168:Tmem132b UTSW 5 125,864,083 (GRCm39) missense probably damaging 0.99
R1418:Tmem132b UTSW 5 125,715,313 (GRCm39) missense probably benign 0.01
R1689:Tmem132b UTSW 5 125,864,678 (GRCm39) missense possibly damaging 0.95
R1744:Tmem132b UTSW 5 125,855,908 (GRCm39) critical splice donor site probably null
R1835:Tmem132b UTSW 5 125,862,963 (GRCm39) missense probably damaging 1.00
R2016:Tmem132b UTSW 5 125,700,080 (GRCm39) missense probably benign
R2033:Tmem132b UTSW 5 125,826,353 (GRCm39) missense probably damaging 0.98
R2097:Tmem132b UTSW 5 125,715,272 (GRCm39) missense probably damaging 0.99
R2114:Tmem132b UTSW 5 125,699,615 (GRCm39) missense probably damaging 1.00
R2116:Tmem132b UTSW 5 125,699,615 (GRCm39) missense probably damaging 1.00
R2117:Tmem132b UTSW 5 125,699,615 (GRCm39) missense probably damaging 1.00
R2870:Tmem132b UTSW 5 125,715,332 (GRCm39) missense probably benign
R2870:Tmem132b UTSW 5 125,715,332 (GRCm39) missense probably benign
R3807:Tmem132b UTSW 5 125,864,644 (GRCm39) missense probably damaging 1.00
R4825:Tmem132b UTSW 5 125,860,497 (GRCm39) missense probably benign
R5149:Tmem132b UTSW 5 125,699,989 (GRCm39) missense probably damaging 0.99
R5484:Tmem132b UTSW 5 125,864,797 (GRCm39) missense probably damaging 1.00
R5623:Tmem132b UTSW 5 125,700,416 (GRCm39) missense probably damaging 0.99
R5624:Tmem132b UTSW 5 125,699,710 (GRCm39) missense probably benign 0.04
R5775:Tmem132b UTSW 5 125,715,394 (GRCm39) critical splice donor site probably null
R7012:Tmem132b UTSW 5 125,775,654 (GRCm39) missense probably damaging 1.00
R7142:Tmem132b UTSW 5 125,699,737 (GRCm39) missense probably damaging 1.00
R7308:Tmem132b UTSW 5 125,864,710 (GRCm39) missense possibly damaging 0.88
R7414:Tmem132b UTSW 5 125,864,555 (GRCm39) missense probably damaging 1.00
R7452:Tmem132b UTSW 5 125,715,332 (GRCm39) missense probably benign
R7650:Tmem132b UTSW 5 125,864,074 (GRCm39) missense probably benign 0.04
R8111:Tmem132b UTSW 5 125,699,857 (GRCm39) missense probably benign 0.00
R8326:Tmem132b UTSW 5 125,864,618 (GRCm39) missense probably damaging 1.00
R8525:Tmem132b UTSW 5 125,715,380 (GRCm39) missense probably benign 0.01
R8900:Tmem132b UTSW 5 125,855,884 (GRCm39) missense probably damaging 0.96
R9147:Tmem132b UTSW 5 125,864,167 (GRCm39) missense probably damaging 1.00
R9148:Tmem132b UTSW 5 125,864,167 (GRCm39) missense probably damaging 1.00
R9179:Tmem132b UTSW 5 125,700,115 (GRCm39) missense probably benign 0.02
R9215:Tmem132b UTSW 5 125,864,180 (GRCm39) missense probably damaging 0.99
R9231:Tmem132b UTSW 5 125,860,531 (GRCm39) missense probably damaging 1.00
R9284:Tmem132b UTSW 5 125,864,711 (GRCm39) missense possibly damaging 0.67
R9311:Tmem132b UTSW 5 125,863,029 (GRCm39) missense possibly damaging 0.56
R9436:Tmem132b UTSW 5 125,775,633 (GRCm39) missense possibly damaging 0.53
R9484:Tmem132b UTSW 5 125,860,420 (GRCm39) missense probably damaging 0.98
R9775:Tmem132b UTSW 5 125,864,566 (GRCm39) missense probably benign 0.07
Z1176:Tmem132b UTSW 5 125,864,950 (GRCm39) missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- GGCCATCTTGGTCTTCCTGATCAAC -3'
(R):5'- TAGTCTCTGAAGTCCTGCGAGTCC -3'

Sequencing Primer
(F):5'- ATCCCGCATTCTCACGACT -3'
(R):5'- GCTGTCATCACTGTCAAACAGG -3'
Posted On 2013-05-23