Incidental Mutation 'R5195:Slc41a3'
ID400092
Institutional Source Beutler Lab
Gene Symbol Slc41a3
Ensembl Gene ENSMUSG00000030089
Gene Namesolute carrier family 41, member 3
Synonyms1010001P06Rik, SLC41A1-L2
MMRRC Submission 042771-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5195 (G1)
Quality Score169
Status Validated
Chromosome6
Chromosomal Location90604725-90646412 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90633671 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 172 (S172P)
Ref Sequence ENSEMBL: ENSMUSP00000037473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032177] [ENSMUST00000044019]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032177
AA Change: S146P

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032177
Gene: ENSMUSG00000030089
AA Change: S146P

DomainStartEndE-ValueType
transmembrane domain 42 64 N/A INTRINSIC
Pfam:MgtE 80 214 3.4e-27 PFAM
transmembrane domain 224 246 N/A INTRINSIC
transmembrane domain 258 277 N/A INTRINSIC
Pfam:MgtE 293 437 9.8e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000044019
AA Change: S172P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037473
Gene: ENSMUSG00000030089
AA Change: S172P

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
Pfam:MgtE 106 240 2.5e-27 PFAM
transmembrane domain 250 272 N/A INTRINSIC
transmembrane domain 284 303 N/A INTRINSIC
Pfam:MgtE 319 463 7.2e-27 PFAM
Meta Mutation Damage Score 0.5647 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (72/74)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered magnesium ion homeostasis including hypomagnesemia. A subset of homozygotes develop severe unilateral hydronephrosis when fed a low magnesium diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700023F06Rik T C 11: 103,198,968 Y381C probably damaging Het
Apoo-ps T C 13: 107,414,553 noncoding transcript Het
Arhgef40 T A 14: 51,989,812 S438T possibly damaging Het
Barhl2 A G 5: 106,453,439 L358P possibly damaging Het
Bicra G A 7: 15,979,953 P775S possibly damaging Het
Ccdc78 T A 17: 25,789,988 probably null Het
Ccnb1-ps T A 7: 42,106,098 noncoding transcript Het
Cct6a A T 5: 129,794,655 noncoding transcript Het
Cep120 T A 18: 53,721,698 H455L probably damaging Het
Cobl C T 11: 12,253,565 V964I probably benign Het
Cpt1a A T 19: 3,383,800 I761F possibly damaging Het
Crk T A 11: 75,679,463 Y14N probably damaging Het
Deup1 A T 9: 15,575,191 Y398N possibly damaging Het
Epha3 C T 16: 63,546,147 G980D possibly damaging Het
Fam196a A T 7: 134,884,416 F469I probably damaging Het
Fanca A G 8: 123,303,945 probably benign Het
Gbp4 T A 5: 105,119,532 D507V probably benign Het
Gtf2i A T 5: 134,244,832 L740* probably null Het
Hmgn2 C A 4: 133,967,286 A8S probably benign Het
Hook2 A T 8: 84,994,776 N252I probably damaging Het
Igkv19-93 T A 6: 68,736,526 T39S probably damaging Het
Inpp5j A C 11: 3,499,889 probably null Het
Kbtbd3 G C 9: 4,316,905 E19Q possibly damaging Het
Kcns2 G A 15: 34,839,531 A347T possibly damaging Het
Klhl31 A G 9: 77,650,290 E96G possibly damaging Het
Kptn A G 7: 16,123,103 Y172C probably damaging Het
Krt86 T A 15: 101,476,933 M328K probably benign Het
Lama1 A G 17: 67,764,800 D894G probably benign Het
Lars2 T C 9: 123,453,310 V653A probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lhcgr A T 17: 88,742,946 V384D probably damaging Het
Malrd1 C T 2: 16,150,810 T2010M unknown Het
Maml2 T A 9: 13,621,114 N541K probably damaging Het
Med24 T C 11: 98,710,281 K585R possibly damaging Het
Muc20 G A 16: 32,794,476 S177L unknown Het
Mylk T A 16: 34,979,215 F1658L probably damaging Het
Obscn C T 11: 59,060,850 V4392I possibly damaging Het
Olfr744 T C 14: 50,618,786 L188P probably damaging Het
Olfr975 A G 9: 39,950,679 S31P probably benign Het
Pcnx2 A T 8: 125,801,549 F1311I possibly damaging Het
Pcsk1 T C 13: 75,126,855 L521P probably damaging Het
Pde4a A G 9: 21,204,333 T445A possibly damaging Het
Pgam5 A T 5: 110,265,988 L103* probably null Het
Pkd2 G A 5: 104,486,681 R526Q probably benign Het
Polr2a T C 11: 69,744,079 Y618C probably damaging Het
Pramef25 T A 4: 143,950,880 E43V probably damaging Het
Pramel5 T A 4: 144,271,741 M311L probably benign Het
Rbbp8 T C 18: 11,722,151 F478L probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryk T C 9: 102,867,613 V122A probably benign Het
Sik3 G T 9: 46,208,844 probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc35e4 T A 11: 3,912,872 I106F possibly damaging Het
Snrnp70 T A 7: 45,394,710 K32N probably damaging Het
Spag17 T C 3: 100,101,388 Y1945H probably benign Het
St7 A G 6: 17,743,637 probably benign Het
Stab1 C A 14: 31,140,521 probably benign Het
Taf13 G A 3: 108,581,074 R91Q probably damaging Het
Tmem200a T C 10: 26,078,956 probably benign Het
Tnc A T 4: 63,967,252 L1871Q probably damaging Het
Toe1 T C 4: 116,804,655 H439R probably damaging Het
Trpm1 T C 7: 64,237,693 V893A possibly damaging Het
Ubr3 G A 2: 69,956,034 A831T probably benign Het
Wdr89 C T 12: 75,633,288 R64Q probably benign Het
Zbed5 G T 5: 129,902,178 V323F probably benign Het
Zeb2 T C 2: 45,001,635 R287G probably damaging Het
Other mutations in Slc41a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Slc41a3 APN 6 90645714 missense probably damaging 1.00
IGL02583:Slc41a3 APN 6 90644171 missense probably damaging 0.99
PIT4378001:Slc41a3 UTSW 6 90640909 missense probably benign 0.36
R1076:Slc41a3 UTSW 6 90644160 missense probably benign
R1529:Slc41a3 UTSW 6 90644216 missense probably damaging 0.99
R1591:Slc41a3 UTSW 6 90633695 missense probably benign 0.02
R1985:Slc41a3 UTSW 6 90642228 missense probably damaging 1.00
R2133:Slc41a3 UTSW 6 90626381 missense probably damaging 0.99
R2308:Slc41a3 UTSW 6 90612120 missense possibly damaging 0.51
R2384:Slc41a3 UTSW 6 90626411 missense probably damaging 0.98
R2697:Slc41a3 UTSW 6 90642320 missense possibly damaging 0.81
R3237:Slc41a3 UTSW 6 90636865 missense probably benign 0.10
R4287:Slc41a3 UTSW 6 90640922 missense probably benign 0.00
R4394:Slc41a3 UTSW 6 90635330 missense probably damaging 1.00
R5039:Slc41a3 UTSW 6 90626417 missense probably damaging 1.00
R5293:Slc41a3 UTSW 6 90626444 missense probably damaging 0.99
R5338:Slc41a3 UTSW 6 90612171 missense possibly damaging 0.93
R5608:Slc41a3 UTSW 6 90640907 missense probably benign 0.06
R5681:Slc41a3 UTSW 6 90640946 missense probably damaging 0.99
R5783:Slc41a3 UTSW 6 90619542 missense probably benign 0.06
R6648:Slc41a3 UTSW 6 90619508 missense probably damaging 0.99
R7867:Slc41a3 UTSW 6 90640927 missense probably damaging 0.96
R7950:Slc41a3 UTSW 6 90640927 missense probably damaging 0.96
X0025:Slc41a3 UTSW 6 90635322 missense probably damaging 1.00
Z1177:Slc41a3 UTSW 6 90619573 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGGATAGAAGGGTCTTGTTTGAC -3'
(R):5'- AGTTCCACACTAGTGCCACG -3'

Sequencing Primer
(F):5'- CCCTTGAGGTGACCAAAAGTC -3'
(R):5'- AGCTTCACTGCAAACCTCTCTGAG -3'
Posted On2016-07-06