Mutagenetix > Incidental Mutation

Incidental Mutation 'R5269:Akap6'

400100

Institutional Source

Beutler Lab

Gene Symbol

Akap6

Ensembl Gene

ENSMUSG00000061603

Gene Name

A kinase (PRKA) anchor protein 6

Synonyms

MMRRC Submission

042834-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.843) question?

Stock #

R5269 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52699383-53155599 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 53139843 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 1347 (C1347R)

Ref Sequence

ENSEMBL: ENSMUSP00000093406 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]

AlphaFold

E9Q9K8

Predicted Effect

probably damaging
Transcript: ENSMUST00000095737
AA Change: C1347R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603
AA Change: C1347R

Domain	Start	End	E-Value	Type
low complexity region	34	51	N/A	INTRINSIC
Blast:SPEC	66	168	2e-50	BLAST
low complexity region	441	455	N/A	INTRINSIC
low complexity region	544	555	N/A	INTRINSIC
low complexity region	569	587	N/A	INTRINSIC
low complexity region	640	651	N/A	INTRINSIC
low complexity region	694	708	N/A	INTRINSIC
SPEC	779	880	1.06e-1	SMART
SPEC	959	1057	1.45e0	SMART
SPEC	1078	1185	2.56e-2	SMART
low complexity region	1316	1332	N/A	INTRINSIC
low complexity region	1555	1568	N/A	INTRINSIC
low complexity region	1610	1622	N/A	INTRINSIC
low complexity region	1683	1698	N/A	INTRINSIC
low complexity region	1737	1781	N/A	INTRINSIC
low complexity region	1899	1910	N/A	INTRINSIC
low complexity region	2019	2031	N/A	INTRINSIC
low complexity region	2104	2115	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000219786

Meta Mutation Damage Score

0.0934

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.9%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	T	C	17: 24,376,743	S357P	possibly damaging	Het
Adam39	A	G	8: 40,825,981	I470V	probably benign	Het
Agrn	A	T	4: 156,168,990	C1708S	probably benign	Het
Agtpbp1	A	G	13: 59,473,743	I42T	probably damaging	Het
Als2cr12	A	G	1: 58,691,760	S46P	possibly damaging	Het
Antxr1	A	G	6: 87,180,183	L452P	probably damaging	Het
Arhgef33	T	A	17: 80,370,275	V417D	probably damaging	Het
Brca2	A	G	5: 150,539,223	I817M	possibly damaging	Het
Casp4	A	T	9: 5,321,521		probably benign	Het
Cdh20	T	C	1: 104,934,157	Y21H	possibly damaging	Het
Cdr2	C	T	7: 120,958,334	V323M	possibly damaging	Het
Cebpa	G	A	7: 35,119,858	R147H	probably benign	Het
Cetn4	C	A	3: 37,309,969	E31*	probably null	Het
Cobll1	G	A	2: 65,133,771	Q189*	probably null	Het
Colec12	A	G	18: 9,846,825	T74A	possibly damaging	Het
Crisp4	A	G	1: 18,128,710	S124P	probably damaging	Het
Eddm3b	T	A	14: 51,116,721	D55E	probably damaging	Het
Elmo1	C	A	13: 20,449,486	N439K	probably benign	Het
Fabp12	T	C	3: 10,250,107	N60S	probably benign	Het
Fam196b	G	A	11: 34,402,788	E277K	probably damaging	Het
Fat2	T	A	11: 55,287,878	H1452L	probably benign	Het
Flrt2	T	C	12: 95,779,938	V350A	possibly damaging	Het
Ganab	T	C	19: 8,911,937	F626S	probably damaging	Het
Ghr	T	C	15: 3,320,079	Y539C	probably benign	Het
Gm6871	T	C	7: 41,548,101	T112A	probably damaging	Het
Gm7133	T	A	1: 97,183,123		noncoding transcript	Het
Gon4l	A	C	3: 88,895,528	I1149L	probably benign	Het
Greb1l	G	A	18: 10,511,409	D45N	probably benign	Het
H2-K1	A	G	17: 33,997,015		probably benign	Het
Herc2	C	T	7: 56,168,870	R2770*	probably null	Het
Itsn2	A	G	12: 4,633,553		probably benign	Het
Klb	A	G	5: 65,348,797	D129G	probably damaging	Het
Klf1	A	G	8: 84,903,340	I265V	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Map3k10	T	C	7: 27,658,532	E607G	probably benign	Het
Melk	C	T	4: 44,363,730	T592M	probably damaging	Het
Mroh6	A	G	15: 75,885,790	L457P	probably damaging	Het
Mrpl21	T	A	19: 3,287,012	C128S	probably damaging	Het
Olfr564	T	C	7: 102,804,120	V214A	probably benign	Het
Paqr4	G	T	17: 23,738,213	H105Q	probably damaging	Het
Pcdhga10	A	G	18: 37,748,694	I503V	probably benign	Het
Pds5a	T	C	5: 65,663,928	N151S	probably damaging	Het
Pif1	A	G	9: 65,591,829	T444A	possibly damaging	Het
Ppp2r3a	T	C	9: 101,153,865	R851G	probably damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Ros1	T	G	10: 52,051,008	Q2172P	probably damaging	Het
Rpe65	A	G	3: 159,604,347	T86A	probably benign	Het
Rpl18a	G	A	8: 70,896,288	R15C	possibly damaging	Het
Sh3tc2	A	G	18: 61,975,613	K258R	probably benign	Het
Ska3	T	A	14: 57,822,116	E84V	possibly damaging	Het
Slc25a40	T	A	5: 8,447,409		probably null	Het
Slf1	A	T	13: 77,104,581	S274T	probably benign	Het
Spata21	A	T	4: 141,103,021	Q267H	probably damaging	Het
Strbp	A	T	2: 37,627,443	W207R	possibly damaging	Het
Taf6l	T	C	19: 8,774,962	E454G	probably damaging	Het
Tcam1	C	A	11: 106,285,527	L360I	probably benign	Het
Tnxb	G	A	17: 34,703,608	R2465H	possibly damaging	Het
Trim66	T	A	7: 109,457,590	Y1120F	probably benign	Het
Trp53	T	A	11: 69,589,205	M243K	probably damaging	Het
Ttl	T	A	2: 129,068,911	C72S	probably damaging	Het
Ttn	A	G	2: 76,708,896	V34582A	probably benign	Het
Uqcrh	T	C	4: 116,069,904	T31A	possibly damaging	Het
Usp40	A	G	1: 87,995,782	C256R	probably benign	Het
Vmn1r168	A	G	7: 23,541,414	E232G	probably benign	Het
Wdr72	A	T	9: 74,157,371	I562F	probably damaging	Het
Wnt4	A	G	4: 137,277,750	N24S	probably benign	Het

Other mutations in Akap6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Akap6	APN	12	53140980	missense	possibly damaging	0.79
IGL00505:Akap6	APN	12	52887102	missense	possibly damaging	0.92
IGL01134:Akap6	APN	12	52937217	missense	probably damaging	0.96
IGL01458:Akap6	APN	12	52886818	nonsense	probably null
IGL01589:Akap6	APN	12	53139664	missense	probably damaging	1.00
IGL01592:Akap6	APN	12	53142142	missense	probably damaging	1.00
IGL01738:Akap6	APN	12	52886817	missense	probably damaging	0.99
IGL01867:Akap6	APN	12	52888008	missense	probably damaging	1.00
IGL02025:Akap6	APN	12	53140335	missense	probably benign
IGL02041:Akap6	APN	12	53140653	missense	probably damaging	1.00
IGL02058:Akap6	APN	12	53140555	missense	probably damaging	1.00
IGL02194:Akap6	APN	12	52886823	missense	probably benign	0.00
IGL02226:Akap6	APN	12	53010467	splice site	probably benign
IGL02323:Akap6	APN	12	53140429	missense	probably benign	0.00
IGL02449:Akap6	APN	12	53140188	missense	probably damaging	1.00
IGL02475:Akap6	APN	12	53139494	missense	probably benign	0.03
IGL02546:Akap6	APN	12	52880738	missense	probably damaging	1.00
IGL02547:Akap6	APN	12	53140696	missense	probably damaging	1.00
IGL02588:Akap6	APN	12	52886499	nonsense	probably null
IGL02608:Akap6	APN	12	53010606	missense	probably benign	0.39
IGL02884:Akap6	APN	12	52886622	missense	probably benign	0.00
IGL02945:Akap6	APN	12	52880837	missense	probably damaging	1.00
IGL03029:Akap6	APN	12	52886412	missense	probably damaging	1.00
IGL03129:Akap6	APN	12	53140306	missense	probably damaging	1.00
R0133:Akap6	UTSW	12	53139471	nonsense	probably null
R0166:Akap6	UTSW	12	53140924	missense	probably benign	0.04
R0189:Akap6	UTSW	12	53141254	missense	probably benign	0.41
R0532:Akap6	UTSW	12	52887983	missense	probably benign	0.00
R0632:Akap6	UTSW	12	52937148	missense	probably damaging	1.00
R0666:Akap6	UTSW	12	52911808	missense	probably damaging	1.00
R0723:Akap6	UTSW	12	53141902	missense	probably damaging	1.00
R0763:Akap6	UTSW	12	53142214	missense	possibly damaging	0.93
R0785:Akap6	UTSW	12	52886622	missense	probably benign	0.00
R0879:Akap6	UTSW	12	52880799	missense	probably damaging	1.00
R0880:Akap6	UTSW	12	53139508	missense	possibly damaging	0.93
R1033:Akap6	UTSW	12	53069222	missense	probably damaging	0.97
R1055:Akap6	UTSW	12	52880672	nonsense	probably null
R1199:Akap6	UTSW	12	52796190	missense	probably damaging	1.00
R1295:Akap6	UTSW	12	52887029	missense	probably damaging	1.00
R1389:Akap6	UTSW	12	53139520	missense	probably benign	0.15
R1471:Akap6	UTSW	12	53141496	missense	probably benign	0.05
R1483:Akap6	UTSW	12	52796087	missense	probably damaging	1.00
R1512:Akap6	UTSW	12	52937154	missense	probably damaging	1.00
R1648:Akap6	UTSW	12	53142006	nonsense	probably null
R1791:Akap6	UTSW	12	53069125	missense	probably damaging	1.00
R1888:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1888:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1891:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1899:Akap6	UTSW	12	53141852	missense	possibly damaging	0.95
R1917:Akap6	UTSW	12	53104612	missense	probably benign	0.13
R1970:Akap6	UTSW	12	52938475	missense	probably damaging	0.96
R1987:Akap6	UTSW	12	53140795	missense	possibly damaging	0.78
R1988:Akap6	UTSW	12	53140795	missense	possibly damaging	0.78
R2153:Akap6	UTSW	12	53141404	missense	probably benign	0.03
R2567:Akap6	UTSW	12	52938373	missense	probably damaging	1.00
R2568:Akap6	UTSW	12	52887278	missense	possibly damaging	0.77
R3025:Akap6	UTSW	12	53140143	missense	probably benign
R3051:Akap6	UTSW	12	52887033	missense	probably damaging	1.00
R3195:Akap6	UTSW	12	53072457	nonsense	probably null
R3196:Akap6	UTSW	12	53072457	nonsense	probably null
R3426:Akap6	UTSW	12	52888034	missense	probably damaging	1.00
R3783:Akap6	UTSW	12	52880769	missense	probably damaging	1.00
R3934:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92
R3936:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92
R3967:Akap6	UTSW	12	53141453	missense	probably damaging	1.00
R3970:Akap6	UTSW	12	53141453	missense	probably damaging	1.00
R4042:Akap6	UTSW	12	53139379	critical splice acceptor site	probably null
R4095:Akap6	UTSW	12	53139462	missense	probably damaging	1.00
R4152:Akap6	UTSW	12	53140407	missense	probably benign	0.45
R4231:Akap6	UTSW	12	53141038	missense	probably damaging	1.00
R4232:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4233:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4234:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4235:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4236:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4475:Akap6	UTSW	12	53141643	missense	probably benign	0.00
R4513:Akap6	UTSW	12	52796004	missense	probably benign	0.03
R4686:Akap6	UTSW	12	52887623	frame shift	probably null
R4724:Akap6	UTSW	12	52795885	missense	possibly damaging	0.80
R4782:Akap6	UTSW	12	52887623	frame shift	probably null
R4852:Akap6	UTSW	12	53104675	missense	probably damaging	1.00
R5024:Akap6	UTSW	12	53142562	missense	probably benign	0.01
R5116:Akap6	UTSW	12	53141515	missense	probably benign	0.01
R5164:Akap6	UTSW	12	53142466	missense	probably benign
R5225:Akap6	UTSW	12	52886546	missense	probably damaging	1.00
R5352:Akap6	UTSW	12	52796097	missense	probably damaging	1.00
R5496:Akap6	UTSW	12	53140653	missense	possibly damaging	0.87
R5551:Akap6	UTSW	12	52795964	missense	probably damaging	1.00
R5997:Akap6	UTSW	12	52937233	critical splice donor site	probably null
R6137:Akap6	UTSW	12	53140354	missense	probably damaging	1.00
R6151:Akap6	UTSW	12	53025792	missense	probably damaging	1.00
R6169:Akap6	UTSW	12	53142358	missense	probably benign
R6307:Akap6	UTSW	12	53141568	missense	possibly damaging	0.85
R6351:Akap6	UTSW	12	53142025	missense	probably damaging	0.98
R6479:Akap6	UTSW	12	53141169	missense	probably damaging	1.00
R6502:Akap6	UTSW	12	53140215	missense	probably damaging	1.00
R6760:Akap6	UTSW	12	53139778	missense	probably damaging	1.00
R6778:Akap6	UTSW	12	53025816	missense	probably damaging	1.00
R6837:Akap6	UTSW	12	53141262	missense	probably damaging	1.00
R6896:Akap6	UTSW	12	52887494	missense	probably benign	0.06
R6917:Akap6	UTSW	12	53069168	missense	probably null	0.97
R6983:Akap6	UTSW	12	52887653	missense	probably damaging	1.00
R7142:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7143:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7216:Akap6	UTSW	12	53140457	missense	probably benign	0.02
R7297:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7356:Akap6	UTSW	12	52911864	missense	probably damaging	1.00
R7378:Akap6	UTSW	12	53142574	missense	probably benign	0.00
R7382:Akap6	UTSW	12	53142171	missense	probably benign	0.00
R7498:Akap6	UTSW	12	53142705	nonsense	probably null
R7542:Akap6	UTSW	12	53069234	missense	probably damaging	1.00
R7589:Akap6	UTSW	12	53142063	nonsense	probably null
R7676:Akap6	UTSW	12	52886850	missense	possibly damaging	0.94
R7814:Akap6	UTSW	12	53140961	missense	probably benign	0.28
R7971:Akap6	UTSW	12	53139795	missense	probably damaging	1.00
R8039:Akap6	UTSW	12	53141676	missense	probably benign	0.00
R8425:Akap6	UTSW	12	52886621	missense	probably benign	0.00
R8747:Akap6	UTSW	12	53142216	missense	probably benign	0.01
R8885:Akap6	UTSW	12	53141536	missense	probably benign
R8956:Akap6	UTSW	12	53140344	missense	probably benign	0.00
R8989:Akap6	UTSW	12	52880871	missense	probably damaging	1.00
R9014:Akap6	UTSW	12	53139620	missense	possibly damaging	0.60
R9031:Akap6	UTSW	12	53142048	missense	probably benign	0.36
R9216:Akap6	UTSW	12	52880885	missense	probably benign	0.05
R9220:Akap6	UTSW	12	53140449	missense	possibly damaging	0.49
R9243:Akap6	UTSW	12	53141252	missense	probably benign	0.08
R9286:Akap6	UTSW	12	53072471	missense	possibly damaging	0.90
R9347:Akap6	UTSW	12	53069111	missense	probably damaging	1.00
R9475:Akap6	UTSW	12	53010552	missense	probably damaging	1.00
R9509:Akap6	UTSW	12	53142238	missense	probably damaging	0.99
R9523:Akap6	UTSW	12	52795889	missense	probably benign	0.02
R9600:Akap6	UTSW	12	52886558	missense	probably benign	0.04
R9612:Akap6	UTSW	12	52911907	missense	probably damaging	1.00
R9627:Akap6	UTSW	12	53104630	missense
R9666:Akap6	UTSW	12	53141535	missense	probably benign
R9784:Akap6	UTSW	12	53141070	missense	probably damaging	1.00
X0062:Akap6	UTSW	12	53142361	missense	probably benign	0.43
Z1176:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- TCCACAATGTTGAGTTCCACG -3'
(R):5'- CTTGAAAGCTTAATGCACTCCCC -3'

Sequencing Primer
(F):5'- CACAATGTTGAGTTCCACGAGGAC -3'
(R):5'- AAGCTTAATGCACTCCCCCTCATC -3'

Posted On

2016-07-06