Mutagenetix > Incidental Mutation

Incidental Mutation 'R5195:Trpm1'

400102

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

042771-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5195 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 64237693 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 893 (V893A)

Ref Sequence

ENSEMBL: ENSMUSP00000146226 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314]

AlphaFold

Q2TV84

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085222
AA Change: V893A

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: V893A

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138074
AA Change: V273A

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206000

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206263
AA Change: V777A

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206277
AA Change: V893A

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Meta Mutation Damage Score

0.1164

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

97% (72/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700023F06Rik	T	C	11: 103,198,968	Y381C	probably damaging	Het
Apoo-ps	T	C	13: 107,414,553		noncoding transcript	Het
Arhgef40	T	A	14: 51,989,812	S438T	possibly damaging	Het
Barhl2	A	G	5: 106,453,439	L358P	possibly damaging	Het
Bicra	G	A	7: 15,979,953	P775S	possibly damaging	Het
Ccdc78	T	A	17: 25,789,988		probably null	Het
Ccnb1-ps	T	A	7: 42,106,098		noncoding transcript	Het
Cct6a	A	T	5: 129,794,655		noncoding transcript	Het
Cep120	T	A	18: 53,721,698	H455L	probably damaging	Het
Cobl	C	T	11: 12,253,565	V964I	probably benign	Het
Cpt1a	A	T	19: 3,383,800	I761F	possibly damaging	Het
Crk	T	A	11: 75,679,463	Y14N	probably damaging	Het
Deup1	A	T	9: 15,575,191	Y398N	possibly damaging	Het
Epha3	C	T	16: 63,546,147	G980D	possibly damaging	Het
Fam196a	A	T	7: 134,884,416	F469I	probably damaging	Het
Fanca	A	G	8: 123,303,945		probably benign	Het
Gbp4	T	A	5: 105,119,532	D507V	probably benign	Het
Gtf2i	A	T	5: 134,244,832	L740*	probably null	Het
Hmgn2	C	A	4: 133,967,286	A8S	probably benign	Het
Hook2	A	T	8: 84,994,776	N252I	probably damaging	Het
Igkv19-93	T	A	6: 68,736,526	T39S	probably damaging	Het
Inpp5j	A	C	11: 3,499,889		probably null	Het
Kbtbd3	G	C	9: 4,316,905	E19Q	possibly damaging	Het
Kcns2	G	A	15: 34,839,531	A347T	possibly damaging	Het
Klhl31	A	G	9: 77,650,290	E96G	possibly damaging	Het
Kptn	A	G	7: 16,123,103	Y172C	probably damaging	Het
Krt86	T	A	15: 101,476,933	M328K	probably benign	Het
Lama1	A	G	17: 67,764,800	D894G	probably benign	Het
Lars2	T	C	9: 123,453,310	V653A	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lhcgr	A	T	17: 88,742,946	V384D	probably damaging	Het
Malrd1	C	T	2: 16,150,810	T2010M	unknown	Het
Maml2	T	A	9: 13,621,114	N541K	probably damaging	Het
Med24	T	C	11: 98,710,281	K585R	possibly damaging	Het
Muc20	G	A	16: 32,794,476	S177L	unknown	Het
Mylk	T	A	16: 34,979,215	F1658L	probably damaging	Het
Obscn	C	T	11: 59,060,850	V4392I	possibly damaging	Het
Olfr744	T	C	14: 50,618,786	L188P	probably damaging	Het
Olfr975	A	G	9: 39,950,679	S31P	probably benign	Het
Pcnx2	A	T	8: 125,801,549	F1311I	possibly damaging	Het
Pcsk1	T	C	13: 75,126,855	L521P	probably damaging	Het
Pde4a	A	G	9: 21,204,333	T445A	possibly damaging	Het
Pgam5	A	T	5: 110,265,988	L103*	probably null	Het
Pkd2	G	A	5: 104,486,681	R526Q	probably benign	Het
Polr2a	T	C	11: 69,744,079	Y618C	probably damaging	Het
Pramef25	T	A	4: 143,950,880	E43V	probably damaging	Het
Pramel5	T	A	4: 144,271,741	M311L	probably benign	Het
Rbbp8	T	C	18: 11,722,151	F478L	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Ryk	T	C	9: 102,867,613	V122A	probably benign	Het
Sik3	G	T	9: 46,208,844		probably null	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Slc35e4	T	A	11: 3,912,872	I106F	possibly damaging	Het
Slc41a3	T	C	6: 90,633,671	S172P	probably damaging	Het
Snrnp70	T	A	7: 45,394,710	K32N	probably damaging	Het
Spag17	T	C	3: 100,101,388	Y1945H	probably benign	Het
St7	A	G	6: 17,743,637		probably benign	Het
Stab1	C	A	14: 31,140,521		probably benign	Het
Taf13	G	A	3: 108,581,074	R91Q	probably damaging	Het
Tmem200a	T	C	10: 26,078,956		probably benign	Het
Tnc	A	T	4: 63,967,252	L1871Q	probably damaging	Het
Toe1	T	C	4: 116,804,655	H439R	probably damaging	Het
Ubr3	G	A	2: 69,956,034	A831T	probably benign	Het
Wdr89	C	T	12: 75,633,288	R64Q	probably benign	Het
Zbed5	G	T	5: 129,902,178	V323F	probably benign	Het
Zeb2	T	C	2: 45,001,635	R287G	probably damaging	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7498:Trpm1	UTSW	7	64208909	missense	possibly damaging	0.93
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ATAGGCTGTCTATGTCAGAGCC -3'
(R):5'- TCTGCACACAACTCTGCATTAC -3'

Sequencing Primer
(F):5'- ATGTCAGAGCCTGTACTGCAC -3'
(R):5'- AACTCTGCATTACTAGCATCGG -3'

Posted On

2016-07-06