Mutagenetix > Incidental Mutation

Incidental Mutation 'R5269:Agtpbp1'

400105

Institutional Source

Beutler Lab

Gene Symbol

Agtpbp1

Ensembl Gene

ENSMUSG00000021557

Gene Name

ATP/GTP binding protein 1

Synonyms

2310001G17Rik, Nna1, 1700020N17Rik, 4930445M19Rik, 2900054O13Rik, 5730402G09Rik

MMRRC Submission

042834-MU

Accession Numbers

Genbank: NM_023328; MGI: 2159437

Essential gene?

Possibly essential (E-score: 0.707) question?

Stock #

R5269 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59445742-59585227 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 59473743 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 42 (I42T)

Ref Sequence

ENSEMBL: ENSMUSP00000153569 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022040] [ENSMUST00000164215] [ENSMUST00000165477] [ENSMUST00000169745] [ENSMUST00000170555] [ENSMUST00000224397]

AlphaFold

Q641K1

Predicted Effect

probably damaging
Transcript: ENSMUST00000022040
AA Change: I985T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022040
Gene: ENSMUSG00000021557
AA Change: I985T

Domain	Start	End	E-Value	Type
low complexity region	362	391	N/A	INTRINSIC
low complexity region	589	603	N/A	INTRINSIC
Pfam:Peptidase_M14	851	1099	1.7e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163149

SMART Domains

Protein: ENSMUSP00000126238
Gene: ENSMUSG00000021557

Domain	Start	End	E-Value	Type
low complexity region	250	279	N/A	INTRINSIC
low complexity region	477	491	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000164215
AA Change: I985T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000130939
Gene: ENSMUSG00000021557
AA Change: I985T

Domain	Start	End	E-Value	Type
low complexity region	362	391	N/A	INTRINSIC
low complexity region	589	603	N/A	INTRINSIC
Pfam:Peptidase_M14	847	1123	1.2e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165477

Predicted Effect

probably benign
Transcript: ENSMUST00000168141

Predicted Effect

probably benign
Transcript: ENSMUST00000169745

Predicted Effect

probably benign
Transcript: ENSMUST00000170555

SMART Domains

Protein: ENSMUSP00000128589
Gene: ENSMUSG00000021557

Domain	Start	End	E-Value	Type
Pfam:V-ATPase_H_N	34	309	2.4e-7	PFAM
low complexity region	362	391	N/A	INTRINSIC
low complexity region	589	603	N/A	INTRINSIC
low complexity region	787	795	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000224397
AA Change: I42T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.8277

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.9%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NNA1 is a zinc carboxypeptidase that contains nuclear localization signals and an ATP/GTP-binding motif that was initially cloned from regenerating spinal cord neurons of the mouse.[supplied by OMIM, Jul 2002]
PHENOTYPE: Homozygotes show moderate ataxia due to degeneration of Purkinje cells of the cerebellum. Also, there is gradual degeneration of retina photoreceptor cells, olfactory bulb mitral cells and some thalamic neurons. Males have abnormal sperm and are sterile. [provided by MGI curators]

Allele List at MGI

All alleles(17) : Gene trapped(6) Transgenic(1) Spontaneous(6) Chemically induced(4)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	T	C	17: 24,376,743	S357P	possibly damaging	Het
Adam39	A	G	8: 40,825,981	I470V	probably benign	Het
Agrn	A	T	4: 156,168,990	C1708S	probably benign	Het
Akap6	T	C	12: 53,139,843	C1347R	probably damaging	Het
Als2cr12	A	G	1: 58,691,760	S46P	possibly damaging	Het
Antxr1	A	G	6: 87,180,183	L452P	probably damaging	Het
Arhgef33	T	A	17: 80,370,275	V417D	probably damaging	Het
Brca2	A	G	5: 150,539,223	I817M	possibly damaging	Het
Casp4	A	T	9: 5,321,521		probably benign	Het
Cdh20	T	C	1: 104,934,157	Y21H	possibly damaging	Het
Cdr2	C	T	7: 120,958,334	V323M	possibly damaging	Het
Cebpa	G	A	7: 35,119,858	R147H	probably benign	Het
Cetn4	C	A	3: 37,309,969	E31*	probably null	Het
Cobll1	G	A	2: 65,133,771	Q189*	probably null	Het
Colec12	A	G	18: 9,846,825	T74A	possibly damaging	Het
Crisp4	A	G	1: 18,128,710	S124P	probably damaging	Het
Eddm3b	T	A	14: 51,116,721	D55E	probably damaging	Het
Elmo1	C	A	13: 20,449,486	N439K	probably benign	Het
Fabp12	T	C	3: 10,250,107	N60S	probably benign	Het
Fam196b	G	A	11: 34,402,788	E277K	probably damaging	Het
Fat2	T	A	11: 55,287,878	H1452L	probably benign	Het
Flrt2	T	C	12: 95,779,938	V350A	possibly damaging	Het
Ganab	T	C	19: 8,911,937	F626S	probably damaging	Het
Ghr	T	C	15: 3,320,079	Y539C	probably benign	Het
Gm6871	T	C	7: 41,548,101	T112A	probably damaging	Het
Gm7133	T	A	1: 97,183,123		noncoding transcript	Het
Gon4l	A	C	3: 88,895,528	I1149L	probably benign	Het
Greb1l	G	A	18: 10,511,409	D45N	probably benign	Het
H2-K1	A	G	17: 33,997,015		probably benign	Het
Herc2	C	T	7: 56,168,870	R2770*	probably null	Het
Itsn2	A	G	12: 4,633,553		probably benign	Het
Klb	A	G	5: 65,348,797	D129G	probably damaging	Het
Klf1	A	G	8: 84,903,340	I265V	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Map3k10	T	C	7: 27,658,532	E607G	probably benign	Het
Melk	C	T	4: 44,363,730	T592M	probably damaging	Het
Mroh6	A	G	15: 75,885,790	L457P	probably damaging	Het
Mrpl21	T	A	19: 3,287,012	C128S	probably damaging	Het
Olfr564	T	C	7: 102,804,120	V214A	probably benign	Het
Paqr4	G	T	17: 23,738,213	H105Q	probably damaging	Het
Pcdhga10	A	G	18: 37,748,694	I503V	probably benign	Het
Pds5a	T	C	5: 65,663,928	N151S	probably damaging	Het
Pif1	A	G	9: 65,591,829	T444A	possibly damaging	Het
Ppp2r3a	T	C	9: 101,153,865	R851G	probably damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Ros1	T	G	10: 52,051,008	Q2172P	probably damaging	Het
Rpe65	A	G	3: 159,604,347	T86A	probably benign	Het
Rpl18a	G	A	8: 70,896,288	R15C	possibly damaging	Het
Sh3tc2	A	G	18: 61,975,613	K258R	probably benign	Het
Ska3	T	A	14: 57,822,116	E84V	possibly damaging	Het
Slc25a40	T	A	5: 8,447,409		probably null	Het
Slf1	A	T	13: 77,104,581	S274T	probably benign	Het
Spata21	A	T	4: 141,103,021	Q267H	probably damaging	Het
Strbp	A	T	2: 37,627,443	W207R	possibly damaging	Het
Taf6l	T	C	19: 8,774,962	E454G	probably damaging	Het
Tcam1	C	A	11: 106,285,527	L360I	probably benign	Het
Tnxb	G	A	17: 34,703,608	R2465H	possibly damaging	Het
Trim66	T	A	7: 109,457,590	Y1120F	probably benign	Het
Trp53	T	A	11: 69,589,205	M243K	probably damaging	Het
Ttl	T	A	2: 129,068,911	C72S	probably damaging	Het
Ttn	A	G	2: 76,708,896	V34582A	probably benign	Het
Uqcrh	T	C	4: 116,069,904	T31A	possibly damaging	Het
Usp40	A	G	1: 87,995,782	C256R	probably benign	Het
Vmn1r168	A	G	7: 23,541,414	E232G	probably benign	Het
Wdr72	A	T	9: 74,157,371	I562F	probably damaging	Het
Wnt4	A	G	4: 137,277,750	N24S	probably benign	Het

Other mutations in Agtpbp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00544:Agtpbp1	APN	13	59450172	missense	probably damaging	1.00
IGL00808:Agtpbp1	APN	13	59462094	missense	possibly damaging	0.84
IGL01298:Agtpbp1	APN	13	59504226	missense	possibly damaging	0.77
IGL01628:Agtpbp1	APN	13	59508063	splice site	probably benign
IGL01921:Agtpbp1	APN	13	59512483	missense	possibly damaging	0.71
IGL02189:Agtpbp1	APN	13	59500461	missense	probably benign	0.01
IGL02325:Agtpbp1	APN	13	59500489	missense	probably benign	0.01
IGL02700:Agtpbp1	APN	13	59528419	missense	probably damaging	1.00
IGL02821:Agtpbp1	APN	13	59482601	missense	possibly damaging	0.69
IGL03130:Agtpbp1	APN	13	59474589	missense	possibly damaging	0.73
IGL03167:Agtpbp1	APN	13	59532080	splice site	probably benign
IGL03218:Agtpbp1	APN	13	59500207	missense	possibly damaging	0.94
bobs	UTSW	13	59482571	missense	possibly damaging	0.53
drunk	UTSW	13	59512323	critical splice donor site	probably benign
gru	UTSW	13	59473746	missense	probably damaging	1.00
rio	UTSW	13	59525241	critical splice acceptor site	probably benign
shreds	UTSW	13	59462088	missense	probably damaging	1.00
Unfocused	UTSW	13	59462070	nonsense	probably null
wobble	UTSW	13	59474550	missense	probably damaging	1.00
R0025:Agtpbp1	UTSW	13	59500200	missense	probably benign	0.00
R0025:Agtpbp1	UTSW	13	59500200	missense	probably benign	0.00
R0276:Agtpbp1	UTSW	13	59462031	missense	possibly damaging	0.93
R0413:Agtpbp1	UTSW	13	59514152	missense	probably damaging	0.99
R0559:Agtpbp1	UTSW	13	59497000	missense	probably benign	0.32
R0848:Agtpbp1	UTSW	13	59533939	intron	probably benign
R0943:Agtpbp1	UTSW	13	59500602	missense	probably benign
R1196:Agtpbp1	UTSW	13	59450318	unclassified	probably benign
R1421:Agtpbp1	UTSW	13	59495575	missense	possibly damaging	0.86
R1531:Agtpbp1	UTSW	13	59500634	splice site	probably null
R1833:Agtpbp1	UTSW	13	59465983	critical splice donor site	probably null
R1864:Agtpbp1	UTSW	13	59450202	missense	possibly damaging	0.92
R1994:Agtpbp1	UTSW	13	59531058	missense	probably damaging	1.00
R1995:Agtpbp1	UTSW	13	59531058	missense	probably damaging	1.00
R2001:Agtpbp1	UTSW	13	59475803	frame shift	probably null
R2006:Agtpbp1	UTSW	13	59500321	missense	probably benign	0.00
R2397:Agtpbp1	UTSW	13	59474569	missense	probably benign	0.10
R2918:Agtpbp1	UTSW	13	59497015	missense	possibly damaging	0.90
R3873:Agtpbp1	UTSW	13	59460596	missense	possibly damaging	0.88
R3924:Agtpbp1	UTSW	13	59500407	missense	probably benign	0.01
R4649:Agtpbp1	UTSW	13	59528399	missense	possibly damaging	0.89
R4913:Agtpbp1	UTSW	13	59500072	missense	probably damaging	1.00
R4933:Agtpbp1	UTSW	13	59500572	missense	probably benign
R4969:Agtpbp1	UTSW	13	59500578	missense	probably benign
R5066:Agtpbp1	UTSW	13	59474550	missense	probably damaging	1.00
R5139:Agtpbp1	UTSW	13	59500213	missense	probably damaging	0.99
R5194:Agtpbp1	UTSW	13	59500639	missense	probably benign	0.19
R5352:Agtpbp1	UTSW	13	59473746	missense	probably damaging	1.00
R5558:Agtpbp1	UTSW	13	59482580	missense	probably benign	0.05
R5687:Agtpbp1	UTSW	13	59500515	missense	probably benign
R5824:Agtpbp1	UTSW	13	59466099	missense	probably damaging	1.00
R5979:Agtpbp1	UTSW	13	59534046	nonsense	probably null
R6109:Agtpbp1	UTSW	13	59473746	missense	probably damaging	1.00
R6264:Agtpbp1	UTSW	13	59450300	missense	possibly damaging	0.89
R6413:Agtpbp1	UTSW	13	59500020	missense	possibly damaging	0.90
R6498:Agtpbp1	UTSW	13	59477040	missense	possibly damaging	0.71
R6747:Agtpbp1	UTSW	13	59544353	splice site	probably null
R6950:Agtpbp1	UTSW	13	59450266	missense	probably benign	0.32
R7030:Agtpbp1	UTSW	13	59504294	missense	probably damaging	1.00
R7180:Agtpbp1	UTSW	13	59466038	missense	probably benign	0.11
R7196:Agtpbp1	UTSW	13	59533180	missense	possibly damaging	0.83
R7535:Agtpbp1	UTSW	13	59504253	missense	probably benign
R7683:Agtpbp1	UTSW	13	59512498	missense	probably damaging	1.00
R7713:Agtpbp1	UTSW	13	59514152	missense	probably damaging	0.99
R8081:Agtpbp1	UTSW	13	59528407	nonsense	probably null
R8210:Agtpbp1	UTSW	13	59482571	missense	possibly damaging	0.53
R8861:Agtpbp1	UTSW	13	59495473	missense	probably damaging	1.00
R9163:Agtpbp1	UTSW	13	59462070	nonsense	probably null
R9199:Agtpbp1	UTSW	13	59465994	missense	probably benign	0.00
R9389:Agtpbp1	UTSW	13	59466070	missense	probably damaging	1.00
R9414:Agtpbp1	UTSW	13	59462088	missense	probably damaging	1.00
R9435:Agtpbp1	UTSW	13	59474615	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- ACTCACGGGAGGAATGTCAG -3'
(R):5'- GAAAAGCCCAGAATTGACACTG -3'

Sequencing Primer
(F):5'- AGGAATGTCAGTCTGCATGC -3'
(R):5'- GACATCGGATTTTCCATGTAGC -3'

Posted On

2016-07-06