Incidental Mutation 'R0456:Lrrc4'
ID40011
Institutional Source Beutler Lab
Gene Symbol Lrrc4
Ensembl Gene ENSMUSG00000049939
Gene Nameleucine rich repeat containing 4
SynonymsNLG-2, Nag14, NGL-2
MMRRC Submission 038656-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R0456 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location28661831-28831747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28831104 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 171 (S171P)
Ref Sequence ENSEMBL: ENSMUSP00000062158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001460] [ENSMUST00000062304] [ENSMUST00000164915] [ENSMUST00000167201] [ENSMUST00000171353]
Predicted Effect probably benign
Transcript: ENSMUST00000001460
SMART Domains Protein: ENSMUSP00000001460
Gene: ENSMUSG00000001424

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 166 7.12e-54 SMART
SNc 193 328 8.37e-51 SMART
SNc 341 496 4.11e-59 SMART
SNc 525 660 3.82e-45 SMART
TUDOR 728 785 4.8e-19 SMART
Pfam:SNase 835 895 1.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000062304
AA Change: S171P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062158
Gene: ENSMUSG00000049939
AA Change: S171P

DomainStartEndE-ValueType
low complexity region 32 40 N/A INTRINSIC
LRRNT 44 78 4.05e-5 SMART
LRR 72 96 1.19e2 SMART
LRR_TYP 97 120 2.24e-3 SMART
LRR 121 144 6.13e-1 SMART
LRR_TYP 145 168 5.99e-4 SMART
LRR 216 239 1.25e-1 SMART
LRR 240 263 4.71e1 SMART
LRR_TYP 264 287 2.79e-4 SMART
LRRCT 299 350 8.06e-6 SMART
IGc2 364 430 5.24e-7 SMART
low complexity region 452 462 N/A INTRINSIC
transmembrane domain 527 549 N/A INTRINSIC
low complexity region 575 586 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164915
SMART Domains Protein: ENSMUSP00000127317
Gene: ENSMUSG00000001424

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 142 1.56e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167201
SMART Domains Protein: ENSMUSP00000128737
Gene: ENSMUSG00000001424

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 166 7.12e-54 SMART
SNc 193 328 8.37e-51 SMART
SNc 341 496 4.11e-59 SMART
SCOP:d1sty__ 526 592 1e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171195
Predicted Effect probably benign
Transcript: ENSMUST00000171353
SMART Domains Protein: ENSMUSP00000129497
Gene: ENSMUSG00000049939

DomainStartEndE-ValueType
low complexity region 29 39 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is significantly downregulated in primary brain tumors. The exact function of the protein encoded by this gene is unknown. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit hyperactivity, an absence of startle reflex, and abnormal ABR amplitude. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 G A 18: 12,295,979 P11L probably damaging Het
Antxr1 A C 6: 87,217,275 V347G probably damaging Het
Atp13a5 T C 16: 29,232,740 N1127D probably benign Het
Bivm T A 1: 44,126,809 W140R probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Ceacam5 T C 7: 17,760,851 V928A possibly damaging Het
Chia1 T C 3: 106,128,479 Y152H probably damaging Het
Chsy3 A T 18: 59,176,478 I268F probably damaging Het
CK137956 A T 4: 127,945,307 N439K probably damaging Het
Csf3r C A 4: 126,035,861 N392K probably damaging Het
Cyp1b1 T C 17: 79,710,275 I484V probably benign Het
Dsc1 T C 18: 20,099,112 K280E probably damaging Het
Eefsec A G 6: 88,297,888 Y365H probably benign Het
Epb41l4b C T 4: 57,142,843 probably null Het
Erap1 G A 13: 74,664,220 V385I probably benign Het
Fat1 A T 8: 45,029,534 I3077F probably damaging Het
Fras1 G T 5: 96,554,788 G230C probably damaging Het
Fras1 T G 5: 96,714,343 probably null Het
Gsg1l A G 7: 125,923,510 M182T possibly damaging Het
Gzmg A G 14: 56,158,322 V60A probably damaging Het
Hapln4 A T 8: 70,084,995 Y113F probably benign Het
Hist1h4f T C 13: 23,551,387 D86G probably damaging Het
Ikzf4 T A 10: 128,635,808 T274S probably damaging Het
Kansl1l T A 1: 66,735,726 H302L probably damaging Het
Klhl41 T C 2: 69,670,549 V118A probably damaging Het
Kpna1 T C 16: 36,002,900 S41P possibly damaging Het
Krt23 A G 11: 99,486,778 V134A probably benign Het
Lamb1 G A 12: 31,304,730 C992Y probably damaging Het
Lrif1 C T 3: 106,731,778 P35S probably benign Het
Lvrn G A 18: 46,864,816 probably null Het
Matr3 T A 18: 35,572,864 F281I probably damaging Het
Nxn G A 11: 76,263,137 Q291* probably null Het
Olfr1467 A G 19: 13,364,738 T37A probably damaging Het
Pdp2 G T 8: 104,593,789 R90L probably damaging Het
Ppp1r3c C A 19: 36,733,891 E160* probably null Het
Ppp2r5c T G 12: 110,522,579 S118R probably damaging Het
Ptpn23 G T 9: 110,389,793 probably null Het
Ptpro G T 6: 137,414,230 V783L probably benign Het
Rab40c A G 17: 25,884,657 V144A possibly damaging Het
Rasal2 T C 1: 157,149,843 N1087S probably damaging Het
Rfc3 T A 5: 151,647,523 S103C possibly damaging Het
Rgl2 A G 17: 33,936,849 probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rit2 A T 18: 30,975,451 F160L probably benign Het
Rnh1 A G 7: 141,162,548 S366P possibly damaging Het
Sdk2 T C 11: 113,791,466 Y2029C possibly damaging Het
Smpd3 T A 8: 106,259,656 I505F probably benign Het
Sorcs3 A T 19: 48,654,044 S379C possibly damaging Het
Sult1e1 A G 5: 87,578,634 L207P possibly damaging Het
Sycp2 C G 2: 178,381,855 S456T probably benign Het
Syne1 T C 10: 5,342,252 T1339A probably benign Het
Tas2r117 A G 6: 132,803,391 N164S probably benign Het
Tigd3 A G 19: 5,892,793 L103P probably damaging Het
Tldc1 A T 8: 119,768,423 F199I probably damaging Het
Tmem132b T C 5: 125,787,724 S965P probably damaging Het
Tmem82 T C 4: 141,617,390 T81A probably benign Het
Tmem8b A G 4: 43,685,618 T156A probably benign Het
Tnfrsf21 A G 17: 43,038,091 E198G probably benign Het
Tnpo2 A G 8: 85,054,416 N767S probably damaging Het
Trf T C 9: 103,226,903 Y87C probably damaging Het
Tst A G 15: 78,405,580 V85A probably damaging Het
Usp37 A T 1: 74,468,348 N503K probably damaging Het
Utp20 C T 10: 88,754,573 M2346I possibly damaging Het
Vax2 A G 6: 83,711,406 D37G probably benign Het
Vmn1r77 T A 7: 12,041,738 L79* probably null Het
Zbtb3 A T 19: 8,803,200 D59V probably damaging Het
Zdhhc13 T C 7: 48,808,854 F182S probably benign Het
Zfp426 A G 9: 20,470,297 F465L probably damaging Het
Zfp526 A G 7: 25,226,212 E632G probably damaging Het
Other mutations in Lrrc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02230:Lrrc4 APN 6 28830880 missense probably damaging 0.99
IGL03223:Lrrc4 APN 6 28831470 missense probably damaging 1.00
IGL03410:Lrrc4 APN 6 28830516 missense probably damaging 1.00
R0233:Lrrc4 UTSW 6 28829735 missense probably benign 0.05
R0233:Lrrc4 UTSW 6 28829735 missense probably benign 0.05
R1162:Lrrc4 UTSW 6 28831084 missense probably damaging 1.00
R2001:Lrrc4 UTSW 6 28830905 missense probably damaging 1.00
R2089:Lrrc4 UTSW 6 28830587 missense probably benign 0.45
R2091:Lrrc4 UTSW 6 28830587 missense probably benign 0.45
R2091:Lrrc4 UTSW 6 28830587 missense probably benign 0.45
R2353:Lrrc4 UTSW 6 28831452 missense probably benign 0.00
R5079:Lrrc4 UTSW 6 28830770 missense possibly damaging 0.69
R5197:Lrrc4 UTSW 6 28830143 missense probably damaging 1.00
R6701:Lrrc4 UTSW 6 28830906 missense possibly damaging 0.95
R6755:Lrrc4 UTSW 6 28831293 missense probably damaging 1.00
R7660:Lrrc4 UTSW 6 28829817 missense probably benign 0.00
R7661:Lrrc4 UTSW 6 28829763 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTCCGTCAAAAGCATTCCGCTC -3'
(R):5'- TCGCCAGTCTCAACACTCTGGAAC -3'

Sequencing Primer
(F):5'- CTGATCTCAGGAAAGTGGTTCCC -3'
(R):5'- CTGGAACTGTTCGACAACTG -3'
Posted On2013-05-23