Mutagenetix > Incidental Mutations

Incidental Mutation 'R5195:Fanca'

400110

Institutional Source

Beutler Lab

Gene Symbol

Fanca

Ensembl Gene

ENSMUSG00000032815

Gene Name

Fanconi anemia, complementation group A

Synonyms

MMRRC Submission

042771-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.587) question?

Stock #

R5195 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123268300-123318576 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to G at 123303945 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000116614 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035495] [ENSMUST00000118395] [ENSMUST00000127664] [ENSMUST00000127904]

Predicted Effect

probably benign
Transcript: ENSMUST00000035495

SMART Domains

Protein: ENSMUSP00000045217
Gene: ENSMUSG00000032815

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	78	100	N/A	INTRINSIC
Pfam:Fanconi_A_N	167	520	3.7e-146	PFAM
low complexity region	645	660	N/A	INTRINSIC
low complexity region	778	790	N/A	INTRINSIC
low complexity region	1069	1079	N/A	INTRINSIC
low complexity region	1200	1225	N/A	INTRINSIC
Pfam:Fanconi_A	1246	1308	8.4e-36	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000118395
AA Change: V466A

SMART Domains

Protein: ENSMUSP00000113125
Gene: ENSMUSG00000032815
AA Change: V466A

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	78	100	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000127904

SMART Domains

Protein: ENSMUSP00000116614
Gene: ENSMUSG00000032815

Domain	Start	End	E-Value	Type
low complexity region	547	562	N/A	INTRINSIC
low complexity region	680	692	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155488

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212953

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

97% (72/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group A. Alternative splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are the most common cause of Fanconi anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants show variably: growth retardation, microphthalmia, craniofacial malformations and hematological changes, depending on allele and strain background. Both sexes show hypogonadism, including diminished primordial germ cells and impaired fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700023F06Rik	T	C	11: 103,198,968	Y381C	probably damaging	Het
Apoo-ps	T	C	13: 107,414,553		noncoding transcript	Het
Arhgef40	T	A	14: 51,989,812	S438T	possibly damaging	Het
Barhl2	A	G	5: 106,453,439	L358P	possibly damaging	Het
Bicra	G	A	7: 15,979,953	P775S	possibly damaging	Het
Ccdc78	T	A	17: 25,789,988		probably null	Het
Ccnb1-ps	T	A	7: 42,106,098		noncoding transcript	Het
Cct6a	A	T	5: 129,794,655		noncoding transcript	Het
Cep120	T	A	18: 53,721,698	H455L	probably damaging	Het
Cobl	C	T	11: 12,253,565	V964I	probably benign	Het
Cpt1a	A	T	19: 3,383,800	I761F	possibly damaging	Het
Crk	T	A	11: 75,679,463	Y14N	probably damaging	Het
Deup1	A	T	9: 15,575,191	Y398N	possibly damaging	Het
Epha3	C	T	16: 63,546,147	G980D	possibly damaging	Het
Fam196a	A	T	7: 134,884,416	F469I	probably damaging	Het
Gbp4	T	A	5: 105,119,532	D507V	probably benign	Het
Gtf2i	A	T	5: 134,244,832	L740*	probably null	Het
Hmgn2	C	A	4: 133,967,286	A8S	probably benign	Het
Hook2	A	T	8: 84,994,776	N252I	probably damaging	Het
Igkv19-93	T	A	6: 68,736,526	T39S	probably damaging	Het
Inpp5j	A	C	11: 3,499,889		probably null	Het
Kbtbd3	G	C	9: 4,316,905	E19Q	possibly damaging	Het
Kcns2	G	A	15: 34,839,531	A347T	possibly damaging	Het
Klhl31	A	G	9: 77,650,290	E96G	possibly damaging	Het
Kptn	A	G	7: 16,123,103	Y172C	probably damaging	Het
Krt86	T	A	15: 101,476,933	M328K	probably benign	Het
Lama1	A	G	17: 67,764,800	D894G	probably benign	Het
Lars2	T	C	9: 123,453,310	V653A	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lhcgr	A	T	17: 88,742,946	V384D	probably damaging	Het
Malrd1	C	T	2: 16,150,810	T2010M	unknown	Het
Maml2	T	A	9: 13,621,114	N541K	probably damaging	Het
Med24	T	C	11: 98,710,281	K585R	possibly damaging	Het
Muc20	G	A	16: 32,794,476	S177L	unknown	Het
Mylk	T	A	16: 34,979,215	F1658L	probably damaging	Het
Obscn	C	T	11: 59,060,850	V4392I	possibly damaging	Het
Olfr744	T	C	14: 50,618,786	L188P	probably damaging	Het
Olfr975	A	G	9: 39,950,679	S31P	probably benign	Het
Pcnx2	A	T	8: 125,801,549	F1311I	possibly damaging	Het
Pcsk1	T	C	13: 75,126,855	L521P	probably damaging	Het
Pde4a	A	G	9: 21,204,333	T445A	possibly damaging	Het
Pgam5	A	T	5: 110,265,988	L103*	probably null	Het
Pkd2	G	A	5: 104,486,681	R526Q	probably benign	Het
Polr2a	T	C	11: 69,744,079	Y618C	probably damaging	Het
Pramef25	T	A	4: 143,950,880	E43V	probably damaging	Het
Pramel5	T	A	4: 144,271,741	M311L	probably benign	Het
Rbbp8	T	C	18: 11,722,151	F478L	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Ryk	T	C	9: 102,867,613	V122A	probably benign	Het
Sik3	G	T	9: 46,208,844		probably null	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Slc35e4	T	A	11: 3,912,872	I106F	possibly damaging	Het
Slc41a3	T	C	6: 90,633,671	S172P	probably damaging	Het
Snrnp70	T	A	7: 45,394,710	K32N	probably damaging	Het
Spag17	T	C	3: 100,101,388	Y1945H	probably benign	Het
St7	A	G	6: 17,743,637		probably benign	Het
Stab1	C	A	14: 31,140,521		probably benign	Het
Taf13	G	A	3: 108,581,074	R91Q	probably damaging	Het
Tmem200a	T	C	10: 26,078,956		probably benign	Het
Tnc	A	T	4: 63,967,252	L1871Q	probably damaging	Het
Toe1	T	C	4: 116,804,655	H439R	probably damaging	Het
Trpm1	T	C	7: 64,237,693	V893A	possibly damaging	Het
Ubr3	G	A	2: 69,956,034	A831T	probably benign	Het
Wdr89	C	T	12: 75,633,288	R64Q	probably benign	Het
Zbed5	G	T	5: 129,902,178	V323F	probably benign	Het
Zeb2	T	C	2: 45,001,635	R287G	probably damaging	Het

Other mutations in Fanca

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02348:Fanca	APN	8	123305263	missense	probably damaging	1.00
IGL02805:Fanca	APN	8	123289494	missense	probably damaging	0.99
IGL03280:Fanca	APN	8	123316459	unclassified	probably benign
PIT4402001:Fanca	UTSW	8	123313064	missense	possibly damaging	0.83
R0114:Fanca	UTSW	8	123288491	splice site	probably null
R0115:Fanca	UTSW	8	123268539	missense	probably benign	0.00
R0271:Fanca	UTSW	8	123272441	unclassified	probably benign
R0330:Fanca	UTSW	8	123274172	nonsense	probably null
R0345:Fanca	UTSW	8	123304813	missense	probably damaging	1.00
R0570:Fanca	UTSW	8	123306430	missense	probably benign	0.01
R0601:Fanca	UTSW	8	123308513	missense	probably damaging	0.99
R0617:Fanca	UTSW	8	123288070	missense	probably damaging	0.99
R0639:Fanca	UTSW	8	123289359	critical splice donor site	probably null
R0943:Fanca	UTSW	8	123274186	missense	probably damaging	1.00
R1140:Fanca	UTSW	8	123313129	splice site	probably null
R1364:Fanca	UTSW	8	123304281	splice site	probably benign
R1366:Fanca	UTSW	8	123304281	splice site	probably benign
R1367:Fanca	UTSW	8	123304281	splice site	probably benign
R1368:Fanca	UTSW	8	123304281	splice site	probably benign
R1969:Fanca	UTSW	8	123288064	missense	probably benign	0.41
R1992:Fanca	UTSW	8	123297812	missense	possibly damaging	0.94
R2060:Fanca	UTSW	8	123274481	missense	probably damaging	1.00
R2174:Fanca	UTSW	8	123271270	missense	probably benign	0.00
R2261:Fanca	UTSW	8	123289359	critical splice donor site	probably null
R3957:Fanca	UTSW	8	123316363	missense	probably benign	0.00
R4062:Fanca	UTSW	8	123275172	missense	probably benign	0.00
R4153:Fanca	UTSW	8	123304878	missense	possibly damaging	0.89
R4270:Fanca	UTSW	8	123268794	missense	probably damaging	1.00
R4424:Fanca	UTSW	8	123288793	missense	probably benign	0.11
R4581:Fanca	UTSW	8	123274338	splice site	probably null
R4639:Fanca	UTSW	8	123318150	missense	probably damaging	0.98
R4664:Fanca	UTSW	8	123268972	missense	probably damaging	0.99
R4665:Fanca	UTSW	8	123268972	missense	probably damaging	0.99
R4666:Fanca	UTSW	8	123268972	missense	probably damaging	0.99
R4686:Fanca	UTSW	8	123268934	splice site	probably benign
R4775:Fanca	UTSW	8	123296306	missense	probably damaging	0.99
R4782:Fanca	UTSW	8	123288202	missense	probably damaging	1.00
R4799:Fanca	UTSW	8	123288202	missense	probably damaging	1.00
R4926:Fanca	UTSW	8	123303985	missense	probably benign	0.05
R4973:Fanca	UTSW	8	123308522	missense	probably damaging	0.96
R5039:Fanca	UTSW	8	123284046	missense	probably benign
R5590:Fanca	UTSW	8	123303963	intron	probably benign
R5848:Fanca	UTSW	8	123295053	intron	probably benign
R5965:Fanca	UTSW	8	123316410	missense	possibly damaging	0.46
R6224:Fanca	UTSW	8	123305281	missense	possibly damaging	0.87
R6385:Fanca	UTSW	8	123305867	splice site	probably null
R6762:Fanca	UTSW	8	123271303	missense	probably benign	0.26
R6795:Fanca	UTSW	8	123318493	missense	probably benign	0.02
R6810:Fanca	UTSW	8	123286477	missense	probably damaging	0.99
R7153:Fanca	UTSW	8	123316425	missense	probably damaging	1.00
R7170:Fanca	UTSW	8	123271206	missense	probably damaging	1.00
R7204:Fanca	UTSW	8	123286477	missense	probably damaging	0.98
R7366:Fanca	UTSW	8	123281213	missense	probably benign	0.08
R7599:Fanca	UTSW	8	123271260	missense	probably benign
R7639:Fanca	UTSW	8	123291395	critical splice donor site	probably null
R7650:Fanca	UTSW	8	123268564	splice site	probably null
R8066:Fanca	UTSW	8	123303940	missense	unknown
R8247:Fanca	UTSW	8	123283955	unclassified	probably benign
R8312:Fanca	UTSW	8	123269810	intron	probably benign
R8327:Fanca	UTSW	8	123313245	nonsense	probably null
V7732:Fanca	UTSW	8	123304281	splice site	probably benign
X0025:Fanca	UTSW	8	123276548	intron	probably benign
X0062:Fanca	UTSW	8	123304852	missense	possibly damaging	0.95
Z1177:Fanca	UTSW	8	123312629	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTGTATCCACACCAGCTGAC -3'
(R):5'- CCAGAAGCTGTCTACTATGCTC -3'

Sequencing Primer
(F):5'- AGCTGACCAAGGATTTCCC -3'
(R):5'- AGAAGCTGTCTACTATGCTCTGCAC -3'

Posted On

2016-07-06