Mutagenetix > Incidental Mutation

Incidental Mutation 'R5269:Greb1l'

400134

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

042834-MU

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5269 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 10511409 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 45 (D45N)

Ref Sequence

ENSEMBL: ENSMUSP00000134314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]

AlphaFold

B9EJV3

Predicted Effect

probably benign
Transcript: ENSMUST00000048977
AA Change: D644N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: D644N

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172532
AA Change: D535N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: D535N

Domain	Start	End	E-Value	Type
low complexity region	83	100	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172680
AA Change: D45N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942
AA Change: D45N

Domain	Start	End	E-Value	Type
low complexity region	116	129	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174553

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.9%

Validation Efficiency

100% (71/71)

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca3	T	C	17: 24,376,743	S357P	possibly damaging	Het
Adam39	A	G	8: 40,825,981	I470V	probably benign	Het
Agrn	A	T	4: 156,168,990	C1708S	probably benign	Het
Agtpbp1	A	G	13: 59,473,743	I42T	probably damaging	Het
Akap6	T	C	12: 53,139,843	C1347R	probably damaging	Het
Als2cr12	A	G	1: 58,691,760	S46P	possibly damaging	Het
Antxr1	A	G	6: 87,180,183	L452P	probably damaging	Het
Arhgef33	T	A	17: 80,370,275	V417D	probably damaging	Het
Brca2	A	G	5: 150,539,223	I817M	possibly damaging	Het
Casp4	A	T	9: 5,321,521		probably benign	Het
Cdh20	T	C	1: 104,934,157	Y21H	possibly damaging	Het
Cdr2	C	T	7: 120,958,334	V323M	possibly damaging	Het
Cebpa	G	A	7: 35,119,858	R147H	probably benign	Het
Cetn4	C	A	3: 37,309,969	E31*	probably null	Het
Cobll1	G	A	2: 65,133,771	Q189*	probably null	Het
Colec12	A	G	18: 9,846,825	T74A	possibly damaging	Het
Crisp4	A	G	1: 18,128,710	S124P	probably damaging	Het
Eddm3b	T	A	14: 51,116,721	D55E	probably damaging	Het
Elmo1	C	A	13: 20,449,486	N439K	probably benign	Het
Fabp12	T	C	3: 10,250,107	N60S	probably benign	Het
Fam196b	G	A	11: 34,402,788	E277K	probably damaging	Het
Fat2	T	A	11: 55,287,878	H1452L	probably benign	Het
Flrt2	T	C	12: 95,779,938	V350A	possibly damaging	Het
Ganab	T	C	19: 8,911,937	F626S	probably damaging	Het
Ghr	T	C	15: 3,320,079	Y539C	probably benign	Het
Gm6871	T	C	7: 41,548,101	T112A	probably damaging	Het
Gm7133	T	A	1: 97,183,123		noncoding transcript	Het
Gon4l	A	C	3: 88,895,528	I1149L	probably benign	Het
H2-K1	A	G	17: 33,997,015		probably benign	Het
Herc2	C	T	7: 56,168,870	R2770*	probably null	Het
Itsn2	A	G	12: 4,633,553		probably benign	Het
Klb	A	G	5: 65,348,797	D129G	probably damaging	Het
Klf1	A	G	8: 84,903,340	I265V	probably benign	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Map3k10	T	C	7: 27,658,532	E607G	probably benign	Het
Melk	C	T	4: 44,363,730	T592M	probably damaging	Het
Mroh6	A	G	15: 75,885,790	L457P	probably damaging	Het
Mrpl21	T	A	19: 3,287,012	C128S	probably damaging	Het
Olfr564	T	C	7: 102,804,120	V214A	probably benign	Het
Paqr4	G	T	17: 23,738,213	H105Q	probably damaging	Het
Pcdhga10	A	G	18: 37,748,694	I503V	probably benign	Het
Pds5a	T	C	5: 65,663,928	N151S	probably damaging	Het
Pif1	A	G	9: 65,591,829	T444A	possibly damaging	Het
Ppp2r3a	T	C	9: 101,153,865	R851G	probably damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Ros1	T	G	10: 52,051,008	Q2172P	probably damaging	Het
Rpe65	A	G	3: 159,604,347	T86A	probably benign	Het
Rpl18a	G	A	8: 70,896,288	R15C	possibly damaging	Het
Sh3tc2	A	G	18: 61,975,613	K258R	probably benign	Het
Ska3	T	A	14: 57,822,116	E84V	possibly damaging	Het
Slc25a40	T	A	5: 8,447,409		probably null	Het
Slf1	A	T	13: 77,104,581	S274T	probably benign	Het
Spata21	A	T	4: 141,103,021	Q267H	probably damaging	Het
Strbp	A	T	2: 37,627,443	W207R	possibly damaging	Het
Taf6l	T	C	19: 8,774,962	E454G	probably damaging	Het
Tcam1	C	A	11: 106,285,527	L360I	probably benign	Het
Tnxb	G	A	17: 34,703,608	R2465H	possibly damaging	Het
Trim66	T	A	7: 109,457,590	Y1120F	probably benign	Het
Trp53	T	A	11: 69,589,205	M243K	probably damaging	Het
Ttl	T	A	2: 129,068,911	C72S	probably damaging	Het
Ttn	A	G	2: 76,708,896	V34582A	probably benign	Het
Uqcrh	T	C	4: 116,069,904	T31A	possibly damaging	Het
Usp40	A	G	1: 87,995,782	C256R	probably benign	Het
Vmn1r168	A	G	7: 23,541,414	E232G	probably benign	Het
Wdr72	A	T	9: 74,157,371	I562F	probably damaging	Het
Wnt4	A	G	4: 137,277,750	N24S	probably benign	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
R8695:Greb1l	UTSW	18	10544450	missense	probably benign	0.01
R8795:Greb1l	UTSW	18	10553739	missense	probably damaging	0.98
R8836:Greb1l	UTSW	18	10509257	missense	probably benign	0.30
R8862:Greb1l	UTSW	18	10555042	missense	possibly damaging	0.90
R8872:Greb1l	UTSW	18	10529684	missense	probably benign	0.18
R8874:Greb1l	UTSW	18	10544896	missense	probably benign	0.01
R8886:Greb1l	UTSW	18	10553843	missense	probably benign	0.21
R8921:Greb1l	UTSW	18	10541825	missense	probably benign	0.01
R8997:Greb1l	UTSW	18	10510747	missense	probably damaging	1.00
R9015:Greb1l	UTSW	18	10541675	missense	probably benign	0.00
R9018:Greb1l	UTSW	18	10542004	missense	possibly damaging	0.76
R9074:Greb1l	UTSW	18	10532797	missense	probably damaging	1.00
R9074:Greb1l	UTSW	18	10558795	missense	probably damaging	1.00
R9117:Greb1l	UTSW	18	10542422	missense	probably benign	0.31
R9189:Greb1l	UTSW	18	10499983	missense	probably benign
R9332:Greb1l	UTSW	18	10532796	missense	possibly damaging	0.92
R9367:Greb1l	UTSW	18	10522130	missense	probably benign	0.00
R9497:Greb1l	UTSW	18	10458600	missense	probably benign	0.00
R9796:Greb1l	UTSW	18	10538233	missense	possibly damaging	0.69
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCCAGCTGCATCAATTG -3'
(R):5'- GGGCTCTTACTAAGGAGAGGAC -3'

Sequencing Primer
(F):5'- CCAGCTGCATCAATTGGATACTG -3'
(R):5'- CTCTTACTAAGGAGAGGACTGCAC -3'

Posted On

2016-07-06