Mutagenetix > Incidental Mutations

Incidental Mutation 'R5195:Stab1'

400159

Institutional Source

Beutler Lab

Gene Symbol

Stab1

Ensembl Gene

ENSMUSG00000042286

Gene Name

stabilin 1

Synonyms

MS-1

MMRRC Submission

042771-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5195 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31139013-31168641 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

C to A at 31140521 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000154613 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036618] [ENSMUST00000090212] [ENSMUST00000159249] [ENSMUST00000160024] [ENSMUST00000226588] [ENSMUST00000227096] [ENSMUST00000227794]

Predicted Effect

probably benign
Transcript: ENSMUST00000036618

SMART Domains

Protein: ENSMUSP00000046199
Gene: ENSMUSG00000042286

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
EGF	112	149	6.65e-2	SMART
EGF	160	194	2.28e0	SMART
EGF	199	232	1.4e0	SMART
EGF	236	272	4.97e-1	SMART
EGF	276	319	1.95e1	SMART
EGF_like	321	357	5.03e1	SMART
low complexity region	400	413	N/A	INTRINSIC
Blast:FAS1	414	501	2e-52	BLAST
FAS1	543	645	1.35e-24	SMART
EGF_like	780	817	5.45e1	SMART
EGF	822	861	1.08e-1	SMART
EGF	865	904	3.15e-3	SMART
EGF	908	947	1.3e1	SMART
EGF	951	989	1.47e1	SMART
FAS1	1023	1122	1.3e-17	SMART
FAS1	1165	1257	2.94e0	SMART
EGF	1332	1369	1.4e0	SMART
EGF	1379	1413	1.88e-1	SMART
EGF	1420	1455	6.02e0	SMART
EGF	1459	1497	3.82e-2	SMART
EGF	1501	1540	2.05e-2	SMART
EGF	1544	1583	2.25e1	SMART
FAS1	1616	1712	1.61e-22	SMART
FAS1	1763	1868	2.12e-17	SMART
EGF	1970	2007	1.26e-2	SMART
EGF	2017	2051	1.61e0	SMART
EGF	2059	2090	2.45e0	SMART
EGF	2094	2131	3.46e0	SMART
EGF	2135	2174	3.82e-2	SMART
LINK	2206	2301	8.55e-49	SMART
FAS1	2367	2462	2.06e-6	SMART
transmembrane domain	2476	2498	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000090212

SMART Domains

Protein: ENSMUSP00000087680
Gene: ENSMUSG00000071547

Domain	Start	End	E-Value	Type
Pfam:5_nucleotid	1	367	1.5e-123	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159208

Predicted Effect

probably benign
Transcript: ENSMUST00000159249

SMART Domains

Protein: ENSMUSP00000125542
Gene: ENSMUSG00000042286

Domain	Start	End	E-Value	Type
EGF	110	147	1.26e-2	SMART
EGF	157	191	1.61e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159480

Predicted Effect

probably benign
Transcript: ENSMUST00000160024

SMART Domains

Protein: ENSMUSP00000125239
Gene: ENSMUSG00000042286

Domain	Start	End	E-Value	Type
Blast:FAS1	1	32	5e-14	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160720

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161129

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161631

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162169

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162763

Predicted Effect

probably benign
Transcript: ENSMUST00000226588

Predicted Effect

probably benign
Transcript: ENSMUST00000226975

Predicted Effect

probably benign
Transcript: ENSMUST00000227096

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227690

Predicted Effect

probably benign
Transcript: ENSMUST00000227794

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

97% (72/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 16 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to endocytose ligands such as low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein rapidly cycles between the plasma membrane and early endosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no physical or behavioral abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700023F06Rik	T	C	11: 103,198,968	Y381C	probably damaging	Het
Apoo-ps	T	C	13: 107,414,553		noncoding transcript	Het
Arhgef40	T	A	14: 51,989,812	S438T	possibly damaging	Het
Barhl2	A	G	5: 106,453,439	L358P	possibly damaging	Het
Bicra	G	A	7: 15,979,953	P775S	possibly damaging	Het
Ccdc78	T	A	17: 25,789,988		probably null	Het
Ccnb1-ps	T	A	7: 42,106,098		noncoding transcript	Het
Cct6a	A	T	5: 129,794,655		noncoding transcript	Het
Cep120	T	A	18: 53,721,698	H455L	probably damaging	Het
Cobl	C	T	11: 12,253,565	V964I	probably benign	Het
Cpt1a	A	T	19: 3,383,800	I761F	possibly damaging	Het
Crk	T	A	11: 75,679,463	Y14N	probably damaging	Het
Deup1	A	T	9: 15,575,191	Y398N	possibly damaging	Het
Epha3	C	T	16: 63,546,147	G980D	possibly damaging	Het
Fam196a	A	T	7: 134,884,416	F469I	probably damaging	Het
Fanca	A	G	8: 123,303,945		probably benign	Het
Gbp4	T	A	5: 105,119,532	D507V	probably benign	Het
Gtf2i	A	T	5: 134,244,832	L740*	probably null	Het
Hmgn2	C	A	4: 133,967,286	A8S	probably benign	Het
Hook2	A	T	8: 84,994,776	N252I	probably damaging	Het
Igkv19-93	T	A	6: 68,736,526	T39S	probably damaging	Het
Inpp5j	A	C	11: 3,499,889		probably null	Het
Kbtbd3	G	C	9: 4,316,905	E19Q	possibly damaging	Het
Kcns2	G	A	15: 34,839,531	A347T	possibly damaging	Het
Klhl31	A	G	9: 77,650,290	E96G	possibly damaging	Het
Kptn	A	G	7: 16,123,103	Y172C	probably damaging	Het
Krt86	T	A	15: 101,476,933	M328K	probably benign	Het
Lama1	A	G	17: 67,764,800	D894G	probably benign	Het
Lars2	T	C	9: 123,453,310	V653A	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lhcgr	A	T	17: 88,742,946	V384D	probably damaging	Het
Malrd1	C	T	2: 16,150,810	T2010M	unknown	Het
Maml2	T	A	9: 13,621,114	N541K	probably damaging	Het
Med24	T	C	11: 98,710,281	K585R	possibly damaging	Het
Muc20	G	A	16: 32,794,476	S177L	unknown	Het
Mylk	T	A	16: 34,979,215	F1658L	probably damaging	Het
Obscn	C	T	11: 59,060,850	V4392I	possibly damaging	Het
Olfr744	T	C	14: 50,618,786	L188P	probably damaging	Het
Olfr975	A	G	9: 39,950,679	S31P	probably benign	Het
Pcnx2	A	T	8: 125,801,549	F1311I	possibly damaging	Het
Pcsk1	T	C	13: 75,126,855	L521P	probably damaging	Het
Pde4a	A	G	9: 21,204,333	T445A	possibly damaging	Het
Pgam5	A	T	5: 110,265,988	L103*	probably null	Het
Pkd2	G	A	5: 104,486,681	R526Q	probably benign	Het
Polr2a	T	C	11: 69,744,079	Y618C	probably damaging	Het
Pramef25	T	A	4: 143,950,880	E43V	probably damaging	Het
Pramel5	T	A	4: 144,271,741	M311L	probably benign	Het
Rbbp8	T	C	18: 11,722,151	F478L	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Ryk	T	C	9: 102,867,613	V122A	probably benign	Het
Sik3	G	T	9: 46,208,844		probably null	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Slc35e4	T	A	11: 3,912,872	I106F	possibly damaging	Het
Slc41a3	T	C	6: 90,633,671	S172P	probably damaging	Het
Snrnp70	T	A	7: 45,394,710	K32N	probably damaging	Het
Spag17	T	C	3: 100,101,388	Y1945H	probably benign	Het
St7	A	G	6: 17,743,637		probably benign	Het
Taf13	G	A	3: 108,581,074	R91Q	probably damaging	Het
Tmem200a	T	C	10: 26,078,956		probably benign	Het
Tnc	A	T	4: 63,967,252	L1871Q	probably damaging	Het
Toe1	T	C	4: 116,804,655	H439R	probably damaging	Het
Trpm1	T	C	7: 64,237,693	V893A	possibly damaging	Het
Ubr3	G	A	2: 69,956,034	A831T	probably benign	Het
Wdr89	C	T	12: 75,633,288	R64Q	probably benign	Het
Zbed5	G	T	5: 129,902,178	V323F	probably benign	Het
Zeb2	T	C	2: 45,001,635	R287G	probably damaging	Het

Other mutations in Stab1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Stab1	APN	14	31161357	missense	probably benign	0.01
IGL00323:Stab1	APN	14	31139306	missense	probably benign	0.04
IGL00515:Stab1	APN	14	31159729	missense	probably benign	0.20
IGL00844:Stab1	APN	14	31147066	missense	probably damaging	1.00
IGL01374:Stab1	APN	14	31147075	missense	probably damaging	1.00
IGL01384:Stab1	APN	14	31150408	missense	probably benign
IGL01431:Stab1	APN	14	31148995	missense	probably benign	0.06
IGL01787:Stab1	APN	14	31139808	missense	probably damaging	1.00
IGL02128:Stab1	APN	14	31150441	missense	probably damaging	1.00
IGL02138:Stab1	APN	14	31143513	critical splice donor site	probably null
IGL02256:Stab1	APN	14	31141592	missense	probably damaging	1.00
IGL02340:Stab1	APN	14	31140410	missense	probably damaging	0.96
IGL02507:Stab1	APN	14	31139210	unclassified	probably benign
IGL02695:Stab1	APN	14	31159271	missense	probably damaging	1.00
IGL02755:Stab1	APN	14	31139638	missense	probably benign	0.01
IGL02870:Stab1	APN	14	31139397	missense	probably benign	0.00
IGL02884:Stab1	APN	14	31150143	splice site	probably null
IGL03035:Stab1	APN	14	31147769	missense	probably benign	0.00
IGL03267:Stab1	APN	14	31142729	missense	probably damaging	1.00
IGL03286:Stab1	APN	14	31159326	splice site	probably benign
IGL03366:Stab1	APN	14	31150263	missense	possibly damaging	0.58
IGL03412:Stab1	APN	14	31154407	missense	probably benign	0.42
IGL02835:Stab1	UTSW	14	31146024	critical splice donor site	probably null
K7371:Stab1	UTSW	14	31150249	missense	probably damaging	1.00
R0053:Stab1	UTSW	14	31140687	missense	possibly damaging	0.57
R0053:Stab1	UTSW	14	31140687	missense	possibly damaging	0.57
R0066:Stab1	UTSW	14	31157070	splice site	probably benign
R0066:Stab1	UTSW	14	31157070	splice site	probably benign
R0363:Stab1	UTSW	14	31159008	splice site	probably benign
R0387:Stab1	UTSW	14	31148101	missense	probably benign	0.00
R0391:Stab1	UTSW	14	31143418	missense	probably benign	0.21
R0513:Stab1	UTSW	14	31148945	missense	probably benign	0.08
R0546:Stab1	UTSW	14	31139550	missense	possibly damaging	0.92
R0825:Stab1	UTSW	14	31152600	missense	probably benign	0.16
R0906:Stab1	UTSW	14	31145249	missense	probably benign	0.19
R0963:Stab1	UTSW	14	31147274	missense	probably damaging	0.97
R1219:Stab1	UTSW	14	31140621	splice site	probably null
R1234:Stab1	UTSW	14	31150236	missense	probably damaging	1.00
R1260:Stab1	UTSW	14	31151889	missense	probably damaging	1.00
R1400:Stab1	UTSW	14	31139830	missense	possibly damaging	0.92
R1405:Stab1	UTSW	14	31149001	missense	probably benign	0.19
R1405:Stab1	UTSW	14	31149001	missense	probably benign	0.19
R1440:Stab1	UTSW	14	31151690	nonsense	probably null
R1472:Stab1	UTSW	14	31141586	missense	probably benign	0.01
R1474:Stab1	UTSW	14	31149861	missense	probably benign	0.45
R1475:Stab1	UTSW	14	31163828	missense	probably benign
R1509:Stab1	UTSW	14	31151584	splice site	probably benign
R1551:Stab1	UTSW	14	31160499	missense	probably benign	0.00
R1572:Stab1	UTSW	14	31150823	missense	probably damaging	1.00
R1633:Stab1	UTSW	14	31150380	splice site	probably null
R1719:Stab1	UTSW	14	31146028	nonsense	probably null
R1733:Stab1	UTSW	14	31145303	missense	probably damaging	1.00
R1763:Stab1	UTSW	14	31168416	missense	probably benign	0.04
R1808:Stab1	UTSW	14	31141144	missense	possibly damaging	0.80
R1816:Stab1	UTSW	14	31157465	missense	probably benign	0.03
R1853:Stab1	UTSW	14	31140463	missense	probably damaging	1.00
R1891:Stab1	UTSW	14	31141330	missense	probably benign	0.07
R1984:Stab1	UTSW	14	31150648	missense	probably benign	0.20
R1998:Stab1	UTSW	14	31162153	nonsense	probably null
R2165:Stab1	UTSW	14	31168435	missense	probably benign	0.20
R2191:Stab1	UTSW	14	31142800	missense	probably benign	0.03
R2191:Stab1	UTSW	14	31159270	missense	probably damaging	1.00
R2233:Stab1	UTSW	14	31161880	missense	probably benign	0.08
R2303:Stab1	UTSW	14	31146070	missense	probably damaging	1.00
R2496:Stab1	UTSW	14	31161463	missense	probably damaging	1.00
R2504:Stab1	UTSW	14	31163040	critical splice donor site	probably null
R2519:Stab1	UTSW	14	31154872	missense	probably damaging	1.00
R2926:Stab1	UTSW	14	31161799	missense	probably damaging	1.00
R4025:Stab1	UTSW	14	31154952	missense	possibly damaging	0.46
R4113:Stab1	UTSW	14	31168479	missense	probably damaging	0.98
R4258:Stab1	UTSW	14	31154672	missense	possibly damaging	0.92
R4588:Stab1	UTSW	14	31157445	missense	probably benign	0.01
R4644:Stab1	UTSW	14	31140487	unclassified	probably benign
R4660:Stab1	UTSW	14	31154915	missense	possibly damaging	0.91
R4801:Stab1	UTSW	14	31141371	nonsense	probably null
R4802:Stab1	UTSW	14	31141371	nonsense	probably null
R4870:Stab1	UTSW	14	31142043	missense	probably benign	0.13
R4872:Stab1	UTSW	14	31140393	missense	probably damaging	1.00
R4881:Stab1	UTSW	14	31143672	missense	probably benign	0.32
R4941:Stab1	UTSW	14	31151571	missense	probably benign	0.00
R5061:Stab1	UTSW	14	31163099	missense	probably damaging	1.00
R5086:Stab1	UTSW	14	31143624	missense	probably damaging	1.00
R5086:Stab1	UTSW	14	31159304	missense	probably damaging	1.00
R5087:Stab1	UTSW	14	31159304	missense	probably damaging	1.00
R5092:Stab1	UTSW	14	31145855	missense	probably benign	0.01
R5102:Stab1	UTSW	14	31148017	critical splice donor site	probably null
R5107:Stab1	UTSW	14	31163795	splice site	probably null
R5217:Stab1	UTSW	14	31159519	missense	probably benign	0.25
R5285:Stab1	UTSW	14	31143476	unclassified	probably benign
R5327:Stab1	UTSW	14	31161836	nonsense	probably null
R5647:Stab1	UTSW	14	31157440	nonsense	probably null
R5696:Stab1	UTSW	14	31160221	missense	probably benign
R5996:Stab1	UTSW	14	31139551	missense	probably benign	0.39
R6016:Stab1	UTSW	14	31158993	missense	probably damaging	1.00
R6017:Stab1	UTSW	14	31141544	missense	probably benign	0.00
R6174:Stab1	UTSW	14	31162519	nonsense	probably null
R6366:Stab1	UTSW	14	31141438	missense	probably benign	0.10
R6754:Stab1	UTSW	14	31141081	missense	probably benign
R6788:Stab1	UTSW	14	31139160	missense	probably damaging	1.00
R6898:Stab1	UTSW	14	31158963	missense	probably benign	0.00
R7124:Stab1	UTSW	14	31160867	missense	possibly damaging	0.94
R7145:Stab1	UTSW	14	31145073	critical splice donor site	probably null
R7153:Stab1	UTSW	14	31160584	missense	probably benign	0.16
R7213:Stab1	UTSW	14	31143673	missense	probably benign
R7215:Stab1	UTSW	14	31160797	missense	possibly damaging	0.93
R7319:Stab1	UTSW	14	31140826	missense	probably damaging	1.00
R7389:Stab1	UTSW	14	31147239	missense	probably benign	0.00
R7400:Stab1	UTSW	14	31157384	missense	probably null	1.00
R7427:Stab1	UTSW	14	31159259	missense	probably benign	0.00
R7428:Stab1	UTSW	14	31159259	missense	probably benign	0.00
R7484:Stab1	UTSW	14	31160317	missense	probably benign	0.00
R7568:Stab1	UTSW	14	31152595	missense	probably damaging	1.00
R7574:Stab1	UTSW	14	31154665	missense	probably benign
R7619:Stab1	UTSW	14	31145237	missense	probably benign
R7623:Stab1	UTSW	14	31140621	missense	probably benign	0.03
R7721:Stab1	UTSW	14	31141456	missense	possibly damaging	0.48
R7869:Stab1	UTSW	14	31154472	missense	probably benign	0.01
R7936:Stab1	UTSW	14	31157415	missense	possibly damaging	0.88
R7956:Stab1	UTSW	14	31160024	missense	probably benign	0.02
R7973:Stab1	UTSW	14	31159633	critical splice donor site	probably null
R8059:Stab1	UTSW	14	31160241	missense	probably benign	0.02
R8116:Stab1	UTSW	14	31158953	missense	possibly damaging	0.80
R8304:Stab1	UTSW	14	31148954	missense	probably benign	0.14
R8368:Stab1	UTSW	14	31148411	missense	possibly damaging	0.91
R8495:Stab1	UTSW	14	31155833	missense	probably damaging	1.00
R8513:Stab1	UTSW	14	31149790	critical splice donor site	probably null
R8544:Stab1	UTSW	14	31163051	nonsense	probably null
X0026:Stab1	UTSW	14	31162191	missense	possibly damaging	0.91
Z1176:Stab1	UTSW	14	31142038	missense	probably benign	0.00
Z1176:Stab1	UTSW	14	31150660	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATTCCCACTTCTGAGGCTGG -3'
(R):5'- TTACAGCTAGGTTTTCATGTCTGC -3'

Sequencing Primer
(F):5'- GGCCCCTGCATACCCCATAG -3'
(R):5'- CATGTCTGCTTCGTGGGC -3'

Posted On

2016-07-06