Incidental Mutation 'R5270:Spag4'
ID 400165
Institutional Source Beutler Lab
Gene Symbol Spag4
Ensembl Gene ENSMUSG00000038180
Gene Name sperm associated antigen 4
Synonyms Sun4, 1700041K21Rik
MMRRC Submission 042835-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5270 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 155907108-155911421 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) G to T at 155907853 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038860] [ENSMUST00000137966] [ENSMUST00000138178]
AlphaFold Q9JJF2
Predicted Effect probably benign
Transcript: ENSMUST00000038860
SMART Domains Protein: ENSMUSP00000036484
Gene: ENSMUSG00000038180

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 19 37 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 166 188 N/A INTRINSIC
low complexity region 214 222 N/A INTRINSIC
Pfam:Sad1_UNC 293 426 1.9e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125996
Predicted Effect probably benign
Transcript: ENSMUST00000131144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136765
Predicted Effect probably benign
Transcript: ENSMUST00000137966
SMART Domains Protein: ENSMUSP00000118715
Gene: ENSMUSG00000038180

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
coiled coil region 112 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149139
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mammalian sperm flagellum contains two cytoskeletal structures associated with the axoneme: the outer dense fibers surrounding the axoneme in the midpiece and principal piece and the fibrous sheath surrounding the outer dense fibers in the principal piece of the tail. Defects in these structures are associated with abnormal tail morphology, reduced sperm motility, and infertility. In the rat, the protein encoded by this gene associates with an outer dense fiber protein via a leucine zipper motif and localizes to the microtubules of the manchette and axoneme during sperm tail development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show disrupted spermiogenesis, severe defects in sperm head formation, abnormal manchette morphology, globozoospermia, and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 T C 19: 55,282,650 (GRCm39) V585A possibly damaging Het
Adam6a A T 12: 113,507,747 (GRCm39) H40L possibly damaging Het
Adamts20 G A 15: 94,180,400 (GRCm39) P1752S probably benign Het
Atp5if1 A G 4: 132,260,611 (GRCm39) F27L probably damaging Het
B230104I21Rik A G 4: 154,434,050 (GRCm39) probably benign Het
Ciz1 C A 2: 32,264,511 (GRCm39) probably null Het
Crb1 T A 1: 139,164,602 (GRCm39) Y1174F probably damaging Het
Csf2rb2 A T 15: 78,176,182 (GRCm39) probably null Het
Cyp3a25 A T 5: 145,918,312 (GRCm39) M433K probably benign Het
Dock4 A G 12: 40,783,270 (GRCm39) I735V probably benign Het
Dpp6 C T 5: 27,839,532 (GRCm39) S349L probably damaging Het
Epg5 T A 18: 78,026,778 (GRCm39) N1256K possibly damaging Het
Epha4 A G 1: 77,483,244 (GRCm39) V255A probably damaging Het
Gabrb1 A T 5: 72,265,669 (GRCm39) D155V probably damaging Het
Gpr35 A T 1: 92,910,299 (GRCm39) T4S probably benign Het
Hcrt T C 11: 100,652,823 (GRCm39) T64A probably damaging Het
Henmt1 G A 3: 108,867,530 (GRCm39) R355H probably benign Het
Hrh1 C A 6: 114,458,179 (GRCm39) R487S possibly damaging Het
Ints2 T C 11: 86,106,621 (GRCm39) S930G probably damaging Het
Irs2 G A 8: 11,056,678 (GRCm39) Q585* probably null Het
Kcns1 C A 2: 164,010,249 (GRCm39) R170L probably benign Het
Kdm3b T C 18: 34,960,467 (GRCm39) S1351P probably damaging Het
Ly9 T C 1: 171,428,730 (GRCm39) T297A probably damaging Het
M6pr G A 6: 122,292,048 (GRCm39) D127N possibly damaging Het
Macir T C 1: 97,573,720 (GRCm39) Q115R probably damaging Het
Nhsl3 T C 4: 129,118,005 (GRCm39) T208A possibly damaging Het
Nit2 G A 16: 56,977,494 (GRCm39) P179S probably damaging Het
Per1 T C 11: 68,994,424 (GRCm39) M516T probably benign Het
Pkdrej A T 15: 85,702,528 (GRCm39) I1136N probably damaging Het
Pramel27 A G 4: 143,578,468 (GRCm39) M243V probably damaging Het
Prdm9 G T 17: 15,773,625 (GRCm39) T257K probably benign Het
Prkdc T C 16: 15,552,819 (GRCm39) L2085P probably damaging Het
Rasgrf1 A C 9: 89,908,747 (GRCm39) E1240D probably benign Het
Rrh T C 3: 129,606,998 (GRCm39) I142V probably benign Het
Saal1 G T 7: 46,351,157 (GRCm39) probably benign Het
Sdcbp2 A G 2: 151,426,812 (GRCm39) I70V probably benign Het
Skida1 C A 2: 18,052,460 (GRCm39) A231S probably benign Het
Smtnl2 T A 11: 72,290,743 (GRCm39) T401S probably benign Het
Sntb1 C G 15: 55,506,191 (GRCm39) G461R probably damaging Het
Tbc1d9 A G 8: 83,960,283 (GRCm39) M179V probably benign Het
Tm9sf1 G T 14: 55,873,938 (GRCm39) T520N probably damaging Het
Tmem163 G A 1: 127,419,289 (GRCm39) probably benign Het
Vmn1r47 A T 6: 89,999,525 (GRCm39) Q219L probably damaging Het
Vmn2r104 A T 17: 20,258,528 (GRCm39) C539S probably damaging Het
Wdr17 G T 8: 55,096,221 (GRCm39) S1024R probably benign Het
Zc3h4 A G 7: 16,168,440 (GRCm39) T850A unknown Het
Zfa-ps A G 10: 52,419,552 (GRCm39) noncoding transcript Het
Zfp146 G T 7: 29,861,900 (GRCm39) N47K probably benign Het
Zfp353-ps G T 8: 42,534,572 (GRCm39) noncoding transcript Het
Zfp607a A T 7: 27,577,730 (GRCm39) K267* probably null Het
Other mutations in Spag4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Spag4 APN 2 155,911,252 (GRCm39) missense possibly damaging 0.88
IGL01843:Spag4 APN 2 155,910,417 (GRCm39) missense probably benign 0.04
IGL02200:Spag4 APN 2 155,908,517 (GRCm39) missense probably benign 0.14
IGL02506:Spag4 APN 2 155,911,142 (GRCm39) missense probably damaging 1.00
IGL02570:Spag4 APN 2 155,910,364 (GRCm39) missense possibly damaging 0.60
IGL03302:Spag4 APN 2 155,910,340 (GRCm39) missense probably damaging 0.97
R0127:Spag4 UTSW 2 155,909,962 (GRCm39) missense probably damaging 0.99
R0314:Spag4 UTSW 2 155,909,229 (GRCm39) unclassified probably benign
R0441:Spag4 UTSW 2 155,909,899 (GRCm39) missense probably damaging 1.00
R1699:Spag4 UTSW 2 155,907,342 (GRCm39) missense probably damaging 1.00
R5293:Spag4 UTSW 2 155,908,111 (GRCm39) missense probably benign 0.07
R6092:Spag4 UTSW 2 155,907,696 (GRCm39) intron probably benign
R7138:Spag4 UTSW 2 155,908,519 (GRCm39) missense probably benign 0.00
R7300:Spag4 UTSW 2 155,907,541 (GRCm39) missense probably benign 0.06
R7898:Spag4 UTSW 2 155,911,244 (GRCm39) missense probably damaging 1.00
R8756:Spag4 UTSW 2 155,908,493 (GRCm39) missense possibly damaging 0.94
R9025:Spag4 UTSW 2 155,910,424 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATAGTTCCCACAGCGCGAC -3'
(R):5'- AGGTTTTGTGCACCACAGG -3'

Sequencing Primer
(F):5'- TTAAGCCCAGGAATGCCCG -3'
(R):5'- ACCACAGGCCCGCTCTTC -3'
Posted On 2016-07-06