Incidental Mutation 'R5195:Mylk'
ID 400170
Institutional Source Beutler Lab
Gene Symbol Mylk
Ensembl Gene ENSMUSG00000022836
Gene Name myosin, light polypeptide kinase
Synonyms Mlck, telokin, nmMlck, 9530072E15Rik, A930019C19Rik, MLCK108, MLCK210
MMRRC Submission 042771-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5195 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 34565580-34822790 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34799585 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 1658 (F1658L)
Ref Sequence ENSEMBL: ENSMUSP00000023538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023538]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000023538
AA Change: F1658L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: F1658L

DomainStartEndE-ValueType
IGc2 54 122 9.05e-11 SMART
IGc2 177 244 3.94e-11 SMART
Pfam:23ISL 255 409 3.6e-60 PFAM
IGc2 423 491 1.55e-9 SMART
IGc2 523 587 3.32e-18 SMART
IGc2 632 699 6.02e-7 SMART
IGc2 730 798 1.36e-5 SMART
low complexity region 827 844 N/A INTRINSIC
IGc2 1141 1208 2.42e-11 SMART
low complexity region 1251 1269 N/A INTRINSIC
IG 1275 1359 4.56e-7 SMART
FN3 1362 1444 2.33e-11 SMART
low complexity region 1457 1479 N/A INTRINSIC
S_TKc 1495 1750 4.23e-95 SMART
IGc2 1852 1920 5.92e-15 SMART
low complexity region 1934 1950 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232482
Meta Mutation Damage Score 0.7061 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apoo-ps T C 13: 107,551,053 (GRCm39) noncoding transcript Het
Arhgef40 T A 14: 52,227,269 (GRCm39) S438T possibly damaging Het
Barhl2 A G 5: 106,601,305 (GRCm39) L358P possibly damaging Het
Bicra G A 7: 15,713,878 (GRCm39) P775S possibly damaging Het
Ccdc78 T A 17: 26,008,962 (GRCm39) probably null Het
Ccnb1-ps T A 7: 41,755,522 (GRCm39) noncoding transcript Het
Cct6a A T 5: 129,871,718 (GRCm39) noncoding transcript Het
Cep120 T A 18: 53,854,770 (GRCm39) H455L probably damaging Het
Cobl C T 11: 12,203,565 (GRCm39) V964I probably benign Het
Cpt1a A T 19: 3,433,800 (GRCm39) I761F possibly damaging Het
Crk T A 11: 75,570,289 (GRCm39) Y14N probably damaging Het
Deup1 A T 9: 15,486,487 (GRCm39) Y398N possibly damaging Het
Efcab15 T C 11: 103,089,794 (GRCm39) Y381C probably damaging Het
Epha3 C T 16: 63,366,510 (GRCm39) G980D possibly damaging Het
Fanca A G 8: 124,030,684 (GRCm39) probably benign Het
Gbp4 T A 5: 105,267,398 (GRCm39) D507V probably benign Het
Gtf2i A T 5: 134,273,686 (GRCm39) L740* probably null Het
Hmgn2 C A 4: 133,694,597 (GRCm39) A8S probably benign Het
Hook2 A T 8: 85,721,405 (GRCm39) N252I probably damaging Het
Igkv19-93 T A 6: 68,713,510 (GRCm39) T39S probably damaging Het
Inpp5j A C 11: 3,449,889 (GRCm39) probably null Het
Insyn2a A T 7: 134,486,145 (GRCm39) F469I probably damaging Het
Kbtbd3 G C 9: 4,316,905 (GRCm39) E19Q possibly damaging Het
Kcns2 G A 15: 34,839,677 (GRCm39) A347T possibly damaging Het
Klhl31 A G 9: 77,557,572 (GRCm39) E96G possibly damaging Het
Kptn A G 7: 15,857,028 (GRCm39) Y172C probably damaging Het
Krt86 T A 15: 101,374,814 (GRCm39) M328K probably benign Het
Lama1 A G 17: 68,071,795 (GRCm39) D894G probably benign Het
Lars2 T C 9: 123,282,375 (GRCm39) V653A probably damaging Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Lhcgr A T 17: 89,050,374 (GRCm39) V384D probably damaging Het
Malrd1 C T 2: 16,155,621 (GRCm39) T2010M unknown Het
Maml2 T A 9: 13,532,410 (GRCm39) N541K probably damaging Het
Med24 T C 11: 98,601,107 (GRCm39) K585R possibly damaging Het
Muc20 G A 16: 32,614,846 (GRCm39) S177L unknown Het
Obscn C T 11: 58,951,676 (GRCm39) V4392I possibly damaging Het
Or10d5 A G 9: 39,861,975 (GRCm39) S31P probably benign Het
Or11g2 T C 14: 50,856,243 (GRCm39) L188P probably damaging Het
Pcnx2 A T 8: 126,528,288 (GRCm39) F1311I possibly damaging Het
Pcsk1 T C 13: 75,274,974 (GRCm39) L521P probably damaging Het
Pde4a A G 9: 21,115,629 (GRCm39) T445A possibly damaging Het
Pgam5 A T 5: 110,413,854 (GRCm39) L103* probably null Het
Pkd2 G A 5: 104,634,547 (GRCm39) R526Q probably benign Het
Polr2a T C 11: 69,634,905 (GRCm39) Y618C probably damaging Het
Pramel16 T A 4: 143,677,450 (GRCm39) E43V probably damaging Het
Pramel5 T A 4: 143,998,311 (GRCm39) M311L probably benign Het
Rbbp8 T C 18: 11,855,208 (GRCm39) F478L probably benign Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Ryk T C 9: 102,744,812 (GRCm39) V122A probably benign Het
Sik3 G T 9: 46,120,142 (GRCm39) probably null Het
Slc22a30 G A 19: 8,321,757 (GRCm39) Q436* probably null Het
Slc35e4 T A 11: 3,862,872 (GRCm39) I106F possibly damaging Het
Slc41a3 T C 6: 90,610,653 (GRCm39) S172P probably damaging Het
Snrnp70 T A 7: 45,044,134 (GRCm39) K32N probably damaging Het
Spag17 T C 3: 100,008,704 (GRCm39) Y1945H probably benign Het
St7 A G 6: 17,743,636 (GRCm39) probably benign Het
Stab1 C A 14: 30,862,478 (GRCm39) probably benign Het
Taf13 G A 3: 108,488,390 (GRCm39) R91Q probably damaging Het
Tmem200a T C 10: 25,954,854 (GRCm39) probably benign Het
Tnc A T 4: 63,885,489 (GRCm39) L1871Q probably damaging Het
Toe1 T C 4: 116,661,852 (GRCm39) H439R probably damaging Het
Trpm1 T C 7: 63,887,441 (GRCm39) V893A possibly damaging Het
Ubr3 G A 2: 69,786,378 (GRCm39) A831T probably benign Het
Wdr89 C T 12: 75,680,062 (GRCm39) R64Q probably benign Het
Zbed5 G T 5: 129,931,019 (GRCm39) V323F probably benign Het
Zeb2 T C 2: 44,891,647 (GRCm39) R287G probably damaging Het
Other mutations in Mylk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Mylk APN 16 34,759,322 (GRCm39) missense probably benign 0.36
IGL01386:Mylk APN 16 34,791,610 (GRCm39) critical splice acceptor site probably null
IGL01684:Mylk APN 16 34,792,310 (GRCm39) missense possibly damaging 0.55
IGL01884:Mylk APN 16 34,809,247 (GRCm39) splice site probably benign
IGL02079:Mylk APN 16 34,681,001 (GRCm39) missense possibly damaging 0.87
IGL02104:Mylk APN 16 34,635,805 (GRCm39) missense probably benign 0.06
IGL02624:Mylk APN 16 34,750,266 (GRCm39) missense probably benign 0.29
IGL02756:Mylk APN 16 34,784,016 (GRCm39) missense probably benign 0.42
IGL02794:Mylk APN 16 34,806,911 (GRCm39) missense probably benign 0.21
IGL02833:Mylk APN 16 34,735,270 (GRCm39) missense probably benign 0.01
IGL02946:Mylk APN 16 34,742,158 (GRCm39) missense probably benign 0.10
IGL03012:Mylk APN 16 34,773,151 (GRCm39) missense probably benign 0.03
IGL03093:Mylk APN 16 34,732,562 (GRCm39) missense possibly damaging 0.62
IGL03272:Mylk APN 16 34,799,559 (GRCm39) missense probably benign 0.09
billy UTSW 16 34,695,990 (GRCm39) missense probably damaging 0.97
brutus UTSW 16 34,774,065 (GRCm39) missense probably benign 0.12
Club UTSW 16 34,732,645 (GRCm39) nonsense probably null
popeye UTSW 16 34,783,947 (GRCm39) missense probably benign 0.29
F5770:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
P4717OSA:Mylk UTSW 16 34,797,483 (GRCm39) splice site probably benign
PIT4382001:Mylk UTSW 16 34,696,012 (GRCm39) missense probably damaging 0.99
R0131:Mylk UTSW 16 34,695,874 (GRCm39) missense probably benign 0.03
R0309:Mylk UTSW 16 34,732,667 (GRCm39) splice site probably benign
R0358:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0381:Mylk UTSW 16 34,605,344 (GRCm39) splice site probably null
R0390:Mylk UTSW 16 34,695,990 (GRCm39) missense probably damaging 0.97
R0413:Mylk UTSW 16 34,742,314 (GRCm39) missense probably benign 0.01
R0536:Mylk UTSW 16 34,820,757 (GRCm39) missense possibly damaging 0.95
R0544:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0545:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0546:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0547:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0548:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0627:Mylk UTSW 16 34,820,799 (GRCm39) missense probably damaging 1.00
R0726:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0755:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0782:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0783:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R0784:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R1136:Mylk UTSW 16 34,820,688 (GRCm39) missense probably damaging 1.00
R1170:Mylk UTSW 16 34,694,409 (GRCm39) missense probably benign 0.20
R1222:Mylk UTSW 16 34,681,022 (GRCm39) missense probably benign 0.12
R1445:Mylk UTSW 16 34,635,835 (GRCm39) missense possibly damaging 0.57
R1583:Mylk UTSW 16 34,695,956 (GRCm39) missense probably benign 0.29
R1618:Mylk UTSW 16 34,699,845 (GRCm39) missense possibly damaging 0.74
R1643:Mylk UTSW 16 34,696,005 (GRCm39) missense probably benign 0.03
R1702:Mylk UTSW 16 34,742,314 (GRCm39) missense probably benign 0.00
R1776:Mylk UTSW 16 34,773,152 (GRCm39) missense probably benign 0.16
R1865:Mylk UTSW 16 34,732,600 (GRCm39) missense probably benign 0.03
R1975:Mylk UTSW 16 34,700,673 (GRCm39) splice site probably null
R2016:Mylk UTSW 16 34,817,187 (GRCm39) missense probably damaging 1.00
R2045:Mylk UTSW 16 34,774,023 (GRCm39) missense probably benign 0.29
R2134:Mylk UTSW 16 34,806,846 (GRCm39) missense probably benign 0.13
R3547:Mylk UTSW 16 34,700,538 (GRCm39) missense possibly damaging 0.61
R3844:Mylk UTSW 16 34,742,247 (GRCm39) missense probably benign 0.01
R4003:Mylk UTSW 16 34,783,947 (GRCm39) missense probably benign 0.29
R4396:Mylk UTSW 16 34,732,645 (GRCm39) nonsense probably null
R4470:Mylk UTSW 16 34,732,522 (GRCm39) missense probably benign 0.09
R4507:Mylk UTSW 16 34,774,065 (GRCm39) missense probably benign 0.12
R4700:Mylk UTSW 16 34,742,805 (GRCm39) missense probably benign 0.16
R4751:Mylk UTSW 16 34,699,539 (GRCm39) missense probably benign 0.29
R4815:Mylk UTSW 16 34,715,295 (GRCm39) missense probably damaging 0.97
R4832:Mylk UTSW 16 34,742,737 (GRCm39) missense probably benign 0.36
R4872:Mylk UTSW 16 34,735,360 (GRCm39) missense possibly damaging 0.89
R4953:Mylk UTSW 16 34,809,331 (GRCm39) missense probably damaging 1.00
R4969:Mylk UTSW 16 34,791,810 (GRCm39) missense probably damaging 0.96
R5009:Mylk UTSW 16 34,719,877 (GRCm39) missense probably benign 0.39
R5130:Mylk UTSW 16 34,809,367 (GRCm39) missense probably damaging 1.00
R5173:Mylk UTSW 16 34,797,383 (GRCm39) missense probably benign 0.40
R5209:Mylk UTSW 16 34,742,995 (GRCm39) missense possibly damaging 0.55
R5311:Mylk UTSW 16 34,742,127 (GRCm39) missense probably benign 0.01
R5418:Mylk UTSW 16 34,732,600 (GRCm39) missense probably benign 0.02
R5481:Mylk UTSW 16 34,741,974 (GRCm39) missense probably benign 0.09
R5590:Mylk UTSW 16 34,699,722 (GRCm39) missense probably benign 0.29
R5603:Mylk UTSW 16 34,776,862 (GRCm39) missense probably benign 0.06
R5823:Mylk UTSW 16 34,715,317 (GRCm39) critical splice donor site probably null
R6290:Mylk UTSW 16 34,715,213 (GRCm39) missense probably benign 0.39
R6351:Mylk UTSW 16 34,742,341 (GRCm39) missense probably benign 0.01
R6365:Mylk UTSW 16 34,680,961 (GRCm39) missense probably benign 0.12
R6490:Mylk UTSW 16 34,750,237 (GRCm39) missense possibly damaging 0.74
R6723:Mylk UTSW 16 34,750,258 (GRCm39) missense possibly damaging 0.74
R6864:Mylk UTSW 16 34,694,520 (GRCm39) missense probably benign 0.03
R6908:Mylk UTSW 16 34,700,643 (GRCm39) missense probably benign 0.18
R6949:Mylk UTSW 16 34,820,688 (GRCm39) missense probably damaging 1.00
R7018:Mylk UTSW 16 34,820,796 (GRCm39) missense possibly damaging 0.88
R7035:Mylk UTSW 16 34,797,352 (GRCm39) missense possibly damaging 0.89
R7162:Mylk UTSW 16 34,742,899 (GRCm39) missense probably damaging 1.00
R7236:Mylk UTSW 16 34,742,899 (GRCm39) missense probably damaging 1.00
R7269:Mylk UTSW 16 34,605,381 (GRCm39) missense probably damaging 0.96
R7475:Mylk UTSW 16 34,734,446 (GRCm39) splice site probably null
R7525:Mylk UTSW 16 34,809,357 (GRCm39) missense probably benign 0.06
R7587:Mylk UTSW 16 34,742,887 (GRCm39) missense probably benign 0.29
R7607:Mylk UTSW 16 34,715,184 (GRCm39) missense probably benign 0.09
R7616:Mylk UTSW 16 34,699,927 (GRCm39) missense probably damaging 0.97
R7647:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7648:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7764:Mylk UTSW 16 34,742,553 (GRCm39) missense probably benign 0.16
R7890:Mylk UTSW 16 34,784,018 (GRCm39) nonsense probably null
R7892:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R7893:Mylk UTSW 16 34,699,894 (GRCm39) missense probably benign 0.29
R8065:Mylk UTSW 16 34,792,389 (GRCm39) missense probably benign 0.08
R8067:Mylk UTSW 16 34,792,389 (GRCm39) missense probably benign 0.08
R8143:Mylk UTSW 16 34,734,525 (GRCm39) missense possibly damaging 0.87
R8210:Mylk UTSW 16 34,820,721 (GRCm39) missense probably damaging 1.00
R8271:Mylk UTSW 16 34,742,949 (GRCm39) missense probably damaging 0.97
R8540:Mylk UTSW 16 34,750,257 (GRCm39) missense possibly damaging 0.87
R8721:Mylk UTSW 16 34,817,176 (GRCm39) missense probably damaging 1.00
R8743:Mylk UTSW 16 34,741,427 (GRCm39) missense probably benign 0.03
R8798:Mylk UTSW 16 34,719,772 (GRCm39) missense possibly damaging 0.89
R8956:Mylk UTSW 16 34,791,779 (GRCm39) missense probably benign 0.01
R9131:Mylk UTSW 16 34,776,835 (GRCm39) missense probably benign 0.29
R9403:Mylk UTSW 16 34,696,012 (GRCm39) nonsense probably null
R9624:Mylk UTSW 16 34,699,677 (GRCm39) missense probably benign 0.29
R9735:Mylk UTSW 16 34,735,179 (GRCm39) missense probably benign 0.09
R9756:Mylk UTSW 16 34,734,387 (GRCm39) missense probably damaging 0.96
R9763:Mylk UTSW 16 34,699,482 (GRCm39) nonsense probably null
RF001:Mylk UTSW 16 34,699,741 (GRCm39) missense probably benign 0.03
V7580:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
V7583:Mylk UTSW 16 34,815,574 (GRCm39) critical splice donor site probably null
X0065:Mylk UTSW 16 34,820,811 (GRCm39) missense probably damaging 1.00
Z1177:Mylk UTSW 16 34,743,021 (GRCm39) missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TCAGGGACAGGTACTTTAATGG -3'
(R):5'- AATGGGACCGGCAACCTATG -3'

Sequencing Primer
(F):5'- GGACAGGTACTTTAATGGCCTCTTC -3'
(R):5'- GCAACCTATGGCCCTCCTG -3'
Posted On 2016-07-06