Mutagenetix > Incidental Mutation

Incidental Mutation 'R5195:Cep120'

400182

Institutional Source

Beutler Lab

Gene Symbol

Cep120

Ensembl Gene

ENSMUSG00000048799

Gene Name

centrosomal protein 120

Synonyms

Ccdc100

MMRRC Submission

042771-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.824) question?

Stock #

R5195 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53681724-53744547 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 53721698 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 455 (H455L)

Ref Sequence

ENSEMBL: ENSMUSP00000062433 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049811]

AlphaFold

Q7TSG1

Predicted Effect

probably damaging
Transcript: ENSMUST00000049811
AA Change: H455L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000062433
Gene: ENSMUSG00000048799
AA Change: H455L

Domain	Start	End	E-Value	Type
Pfam:C2	9	114	4.8e-5	PFAM
Pfam:DUF3668	118	340	1e-96	PFAM
low complexity region	378	396	N/A	INTRINSIC
Pfam:C2	520	568	1.9e-3	PFAM
low complexity region	632	642	N/A	INTRINSIC
SCOP:d1eq1a_	661	803	2e-4	SMART

Meta Mutation Damage Score

0.5422

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

97% (72/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the microtubule-dependent coupling of the nucleus and the centrosome. A similar protein in mouse plays a role in both interkinetic nuclear migration, which is a characteristic pattern of nuclear movement in neural progenitors, and in neural progenitor self-renewal. Mutations in this gene are predicted to result in neurogenic defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic growth arrest at E8.5 and die during organogenesis exhibiting abnormal direction of heart looping. Primary mouse embryonic fibroblasts lack cilia and either one or both centrioles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700023F06Rik	T	C	11: 103,198,968	Y381C	probably damaging	Het
Apoo-ps	T	C	13: 107,414,553		noncoding transcript	Het
Arhgef40	T	A	14: 51,989,812	S438T	possibly damaging	Het
Barhl2	A	G	5: 106,453,439	L358P	possibly damaging	Het
Bicra	G	A	7: 15,979,953	P775S	possibly damaging	Het
Ccdc78	T	A	17: 25,789,988		probably null	Het
Ccnb1-ps	T	A	7: 42,106,098		noncoding transcript	Het
Cct6a	A	T	5: 129,794,655		noncoding transcript	Het
Cobl	C	T	11: 12,253,565	V964I	probably benign	Het
Cpt1a	A	T	19: 3,383,800	I761F	possibly damaging	Het
Crk	T	A	11: 75,679,463	Y14N	probably damaging	Het
Deup1	A	T	9: 15,575,191	Y398N	possibly damaging	Het
Epha3	C	T	16: 63,546,147	G980D	possibly damaging	Het
Fam196a	A	T	7: 134,884,416	F469I	probably damaging	Het
Fanca	A	G	8: 123,303,945		probably benign	Het
Gbp4	T	A	5: 105,119,532	D507V	probably benign	Het
Gtf2i	A	T	5: 134,244,832	L740*	probably null	Het
Hmgn2	C	A	4: 133,967,286	A8S	probably benign	Het
Hook2	A	T	8: 84,994,776	N252I	probably damaging	Het
Igkv19-93	T	A	6: 68,736,526	T39S	probably damaging	Het
Inpp5j	A	C	11: 3,499,889		probably null	Het
Kbtbd3	G	C	9: 4,316,905	E19Q	possibly damaging	Het
Kcns2	G	A	15: 34,839,531	A347T	possibly damaging	Het
Klhl31	A	G	9: 77,650,290	E96G	possibly damaging	Het
Kptn	A	G	7: 16,123,103	Y172C	probably damaging	Het
Krt86	T	A	15: 101,476,933	M328K	probably benign	Het
Lama1	A	G	17: 67,764,800	D894G	probably benign	Het
Lars2	T	C	9: 123,453,310	V653A	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lhcgr	A	T	17: 88,742,946	V384D	probably damaging	Het
Malrd1	C	T	2: 16,150,810	T2010M	unknown	Het
Maml2	T	A	9: 13,621,114	N541K	probably damaging	Het
Med24	T	C	11: 98,710,281	K585R	possibly damaging	Het
Muc20	G	A	16: 32,794,476	S177L	unknown	Het
Mylk	T	A	16: 34,979,215	F1658L	probably damaging	Het
Obscn	C	T	11: 59,060,850	V4392I	possibly damaging	Het
Olfr744	T	C	14: 50,618,786	L188P	probably damaging	Het
Olfr975	A	G	9: 39,950,679	S31P	probably benign	Het
Pcnx2	A	T	8: 125,801,549	F1311I	possibly damaging	Het
Pcsk1	T	C	13: 75,126,855	L521P	probably damaging	Het
Pde4a	A	G	9: 21,204,333	T445A	possibly damaging	Het
Pgam5	A	T	5: 110,265,988	L103*	probably null	Het
Pkd2	G	A	5: 104,486,681	R526Q	probably benign	Het
Polr2a	T	C	11: 69,744,079	Y618C	probably damaging	Het
Pramef25	T	A	4: 143,950,880	E43V	probably damaging	Het
Pramel5	T	A	4: 144,271,741	M311L	probably benign	Het
Rbbp8	T	C	18: 11,722,151	F478L	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Ryk	T	C	9: 102,867,613	V122A	probably benign	Het
Sik3	G	T	9: 46,208,844		probably null	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Slc35e4	T	A	11: 3,912,872	I106F	possibly damaging	Het
Slc41a3	T	C	6: 90,633,671	S172P	probably damaging	Het
Snrnp70	T	A	7: 45,394,710	K32N	probably damaging	Het
Spag17	T	C	3: 100,101,388	Y1945H	probably benign	Het
St7	A	G	6: 17,743,637		probably benign	Het
Stab1	C	A	14: 31,140,521		probably benign	Het
Taf13	G	A	3: 108,581,074	R91Q	probably damaging	Het
Tmem200a	T	C	10: 26,078,956		probably benign	Het
Tnc	A	T	4: 63,967,252	L1871Q	probably damaging	Het
Toe1	T	C	4: 116,804,655	H439R	probably damaging	Het
Trpm1	T	C	7: 64,237,693	V893A	possibly damaging	Het
Ubr3	G	A	2: 69,956,034	A831T	probably benign	Het
Wdr89	C	T	12: 75,633,288	R64Q	probably benign	Het
Zbed5	G	T	5: 129,902,178	V323F	probably benign	Het
Zeb2	T	C	2: 45,001,635	R287G	probably damaging	Het

Other mutations in Cep120

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01544:Cep120	APN	18	53685961	missense	probably benign	0.24
IGL01774:Cep120	APN	18	53706830	missense	possibly damaging	0.92
IGL01862:Cep120	APN	18	53714767	missense	probably benign	0.01
IGL01906:Cep120	APN	18	53714912	missense	probably benign
IGL01941:Cep120	APN	18	53723148	missense	probably benign	0.00
IGL02952:Cep120	APN	18	53683228	utr 3 prime	probably benign
IGL03248:Cep120	APN	18	53735772	missense	probably benign	0.04
IGL03379:Cep120	APN	18	53709136	missense	probably benign
R0019:Cep120	UTSW	18	53709047	splice site	probably benign
R0039:Cep120	UTSW	18	53685961	missense	probably benign	0.24
R0763:Cep120	UTSW	18	53721737	missense	probably benign	0.00
R1015:Cep120	UTSW	18	53703121	critical splice donor site	probably null
R1340:Cep120	UTSW	18	53724391	missense	probably damaging	1.00
R1507:Cep120	UTSW	18	53697657	missense	probably damaging	0.99
R1649:Cep120	UTSW	18	53724576	missense	probably damaging	1.00
R1727:Cep120	UTSW	18	53727729	missense	probably benign	0.01
R1739:Cep120	UTSW	18	53719214	critical splice donor site	probably null
R1873:Cep120	UTSW	18	53738488	missense	probably damaging	0.98
R1913:Cep120	UTSW	18	53723286	missense	probably benign	0.26
R1968:Cep120	UTSW	18	53723241	missense	probably benign	0.42
R1995:Cep120	UTSW	18	53740136	missense	probably damaging	1.00
R2042:Cep120	UTSW	18	53735742	missense	possibly damaging	0.50
R2074:Cep120	UTSW	18	53719312	missense	possibly damaging	0.83
R2116:Cep120	UTSW	18	53740136	missense	probably damaging	1.00
R2215:Cep120	UTSW	18	53727635	missense	probably damaging	1.00
R2697:Cep120	UTSW	18	53740125	missense	probably benign	0.00
R3813:Cep120	UTSW	18	53740212	splice site	probably benign
R4012:Cep120	UTSW	18	53738582	missense	probably damaging	0.99
R4368:Cep120	UTSW	18	53685885	splice site	probably null
R4615:Cep120	UTSW	18	53714841	missense	probably damaging	1.00
R4772:Cep120	UTSW	18	53718489	missense	probably damaging	1.00
R4780:Cep120	UTSW	18	53724536	missense	probably benign	0.12
R5991:Cep120	UTSW	18	53721798	missense	probably benign
R6156:Cep120	UTSW	18	53703223	missense	probably benign	0.00
R6188:Cep120	UTSW	18	53724457	missense	probably benign	0.03
R6688:Cep120	UTSW	18	53724536	missense	probably benign	0.12
R6961:Cep120	UTSW	18	53703205	nonsense	probably null
R7143:Cep120	UTSW	18	53683385	missense	probably benign	0.00
R7282:Cep120	UTSW	18	53740089	missense	probably damaging	1.00
R7813:Cep120	UTSW	18	53738506	missense	probably damaging	1.00
R7818:Cep120	UTSW	18	53723103	missense	probably benign
R8677:Cep120	UTSW	18	53738561	missense	possibly damaging	0.90
R8724:Cep120	UTSW	18	53723127	missense	possibly damaging	0.88
R9164:Cep120	UTSW	18	53719246	missense	probably benign	0.02
R9225:Cep120	UTSW	18	53706824	missense	probably benign	0.00
R9300:Cep120	UTSW	18	53719297	missense	probably damaging	0.99
R9312:Cep120	UTSW	18	53727641	missense	probably benign	0.08
R9377:Cep120	UTSW	18	53718520	missense	possibly damaging	0.66
R9390:Cep120	UTSW	18	53706912	nonsense	probably null
R9499:Cep120	UTSW	18	53685961	missense	possibly damaging	0.94
R9551:Cep120	UTSW	18	53685961	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- AGAGCTACCCTGGATCCAAC -3'
(R):5'- CAGTTCCTGTGTTCATAAAGCAGATC -3'

Sequencing Primer
(F):5'- ACCCTGGATCCAACTTAGTCATTAGG -3'
(R):5'- AGCAGATCTGTCAGACTCTGAGC -3'

Posted On

2016-07-06