Incidental Mutation 'R5195:Cep120'
ID 400182
Institutional Source Beutler Lab
Gene Symbol Cep120
Ensembl Gene ENSMUSG00000048799
Gene Name centrosomal protein 120
Synonyms Ccdc100
MMRRC Submission 042771-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.773) question?
Stock # R5195 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 53814795-53877680 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 53854770 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 455 (H455L)
Ref Sequence ENSEMBL: ENSMUSP00000062433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049811]
AlphaFold Q7TSG1
Predicted Effect probably damaging
Transcript: ENSMUST00000049811
AA Change: H455L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062433
Gene: ENSMUSG00000048799
AA Change: H455L

DomainStartEndE-ValueType
Pfam:C2 9 114 4.8e-5 PFAM
Pfam:DUF3668 118 340 1e-96 PFAM
low complexity region 378 396 N/A INTRINSIC
Pfam:C2 520 568 1.9e-3 PFAM
low complexity region 632 642 N/A INTRINSIC
SCOP:d1eq1a_ 661 803 2e-4 SMART
Meta Mutation Damage Score 0.5422 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the microtubule-dependent coupling of the nucleus and the centrosome. A similar protein in mouse plays a role in both interkinetic nuclear migration, which is a characteristic pattern of nuclear movement in neural progenitors, and in neural progenitor self-renewal. Mutations in this gene are predicted to result in neurogenic defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic growth arrest at E8.5 and die during organogenesis exhibiting abnormal direction of heart looping. Primary mouse embryonic fibroblasts lack cilia and either one or both centrioles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apoo-ps T C 13: 107,551,053 (GRCm39) noncoding transcript Het
Arhgef40 T A 14: 52,227,269 (GRCm39) S438T possibly damaging Het
Barhl2 A G 5: 106,601,305 (GRCm39) L358P possibly damaging Het
Bicra G A 7: 15,713,878 (GRCm39) P775S possibly damaging Het
Ccdc78 T A 17: 26,008,962 (GRCm39) probably null Het
Ccnb1-ps T A 7: 41,755,522 (GRCm39) noncoding transcript Het
Cct6a A T 5: 129,871,718 (GRCm39) noncoding transcript Het
Cobl C T 11: 12,203,565 (GRCm39) V964I probably benign Het
Cpt1a A T 19: 3,433,800 (GRCm39) I761F possibly damaging Het
Crk T A 11: 75,570,289 (GRCm39) Y14N probably damaging Het
Deup1 A T 9: 15,486,487 (GRCm39) Y398N possibly damaging Het
Efcab15 T C 11: 103,089,794 (GRCm39) Y381C probably damaging Het
Epha3 C T 16: 63,366,510 (GRCm39) G980D possibly damaging Het
Fanca A G 8: 124,030,684 (GRCm39) probably benign Het
Gbp4 T A 5: 105,267,398 (GRCm39) D507V probably benign Het
Gtf2i A T 5: 134,273,686 (GRCm39) L740* probably null Het
Hmgn2 C A 4: 133,694,597 (GRCm39) A8S probably benign Het
Hook2 A T 8: 85,721,405 (GRCm39) N252I probably damaging Het
Igkv19-93 T A 6: 68,713,510 (GRCm39) T39S probably damaging Het
Inpp5j A C 11: 3,449,889 (GRCm39) probably null Het
Insyn2a A T 7: 134,486,145 (GRCm39) F469I probably damaging Het
Kbtbd3 G C 9: 4,316,905 (GRCm39) E19Q possibly damaging Het
Kcns2 G A 15: 34,839,677 (GRCm39) A347T possibly damaging Het
Klhl31 A G 9: 77,557,572 (GRCm39) E96G possibly damaging Het
Kptn A G 7: 15,857,028 (GRCm39) Y172C probably damaging Het
Krt86 T A 15: 101,374,814 (GRCm39) M328K probably benign Het
Lama1 A G 17: 68,071,795 (GRCm39) D894G probably benign Het
Lars2 T C 9: 123,282,375 (GRCm39) V653A probably damaging Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Lhcgr A T 17: 89,050,374 (GRCm39) V384D probably damaging Het
Malrd1 C T 2: 16,155,621 (GRCm39) T2010M unknown Het
Maml2 T A 9: 13,532,410 (GRCm39) N541K probably damaging Het
Med24 T C 11: 98,601,107 (GRCm39) K585R possibly damaging Het
Muc20 G A 16: 32,614,846 (GRCm39) S177L unknown Het
Mylk T A 16: 34,799,585 (GRCm39) F1658L probably damaging Het
Obscn C T 11: 58,951,676 (GRCm39) V4392I possibly damaging Het
Or10d5 A G 9: 39,861,975 (GRCm39) S31P probably benign Het
Or11g2 T C 14: 50,856,243 (GRCm39) L188P probably damaging Het
Pcnx2 A T 8: 126,528,288 (GRCm39) F1311I possibly damaging Het
Pcsk1 T C 13: 75,274,974 (GRCm39) L521P probably damaging Het
Pde4a A G 9: 21,115,629 (GRCm39) T445A possibly damaging Het
Pgam5 A T 5: 110,413,854 (GRCm39) L103* probably null Het
Pkd2 G A 5: 104,634,547 (GRCm39) R526Q probably benign Het
Polr2a T C 11: 69,634,905 (GRCm39) Y618C probably damaging Het
Pramel16 T A 4: 143,677,450 (GRCm39) E43V probably damaging Het
Pramel5 T A 4: 143,998,311 (GRCm39) M311L probably benign Het
Rbbp8 T C 18: 11,855,208 (GRCm39) F478L probably benign Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Ryk T C 9: 102,744,812 (GRCm39) V122A probably benign Het
Sik3 G T 9: 46,120,142 (GRCm39) probably null Het
Slc22a30 G A 19: 8,321,757 (GRCm39) Q436* probably null Het
Slc35e4 T A 11: 3,862,872 (GRCm39) I106F possibly damaging Het
Slc41a3 T C 6: 90,610,653 (GRCm39) S172P probably damaging Het
Snrnp70 T A 7: 45,044,134 (GRCm39) K32N probably damaging Het
Spag17 T C 3: 100,008,704 (GRCm39) Y1945H probably benign Het
St7 A G 6: 17,743,636 (GRCm39) probably benign Het
Stab1 C A 14: 30,862,478 (GRCm39) probably benign Het
Taf13 G A 3: 108,488,390 (GRCm39) R91Q probably damaging Het
Tmem200a T C 10: 25,954,854 (GRCm39) probably benign Het
Tnc A T 4: 63,885,489 (GRCm39) L1871Q probably damaging Het
Toe1 T C 4: 116,661,852 (GRCm39) H439R probably damaging Het
Trpm1 T C 7: 63,887,441 (GRCm39) V893A possibly damaging Het
Ubr3 G A 2: 69,786,378 (GRCm39) A831T probably benign Het
Wdr89 C T 12: 75,680,062 (GRCm39) R64Q probably benign Het
Zbed5 G T 5: 129,931,019 (GRCm39) V323F probably benign Het
Zeb2 T C 2: 44,891,647 (GRCm39) R287G probably damaging Het
Other mutations in Cep120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Cep120 APN 18 53,819,033 (GRCm39) missense probably benign 0.24
IGL01774:Cep120 APN 18 53,839,902 (GRCm39) missense possibly damaging 0.92
IGL01862:Cep120 APN 18 53,847,839 (GRCm39) missense probably benign 0.01
IGL01906:Cep120 APN 18 53,847,984 (GRCm39) missense probably benign
IGL01941:Cep120 APN 18 53,856,220 (GRCm39) missense probably benign 0.00
IGL02952:Cep120 APN 18 53,816,300 (GRCm39) utr 3 prime probably benign
IGL03248:Cep120 APN 18 53,868,844 (GRCm39) missense probably benign 0.04
IGL03379:Cep120 APN 18 53,842,208 (GRCm39) missense probably benign
R0019:Cep120 UTSW 18 53,842,119 (GRCm39) splice site probably benign
R0039:Cep120 UTSW 18 53,819,033 (GRCm39) missense probably benign 0.24
R0763:Cep120 UTSW 18 53,854,809 (GRCm39) missense probably benign 0.00
R1015:Cep120 UTSW 18 53,836,193 (GRCm39) critical splice donor site probably null
R1340:Cep120 UTSW 18 53,857,463 (GRCm39) missense probably damaging 1.00
R1507:Cep120 UTSW 18 53,830,729 (GRCm39) missense probably damaging 0.99
R1649:Cep120 UTSW 18 53,857,648 (GRCm39) missense probably damaging 1.00
R1727:Cep120 UTSW 18 53,860,801 (GRCm39) missense probably benign 0.01
R1739:Cep120 UTSW 18 53,852,286 (GRCm39) critical splice donor site probably null
R1873:Cep120 UTSW 18 53,871,560 (GRCm39) missense probably damaging 0.98
R1913:Cep120 UTSW 18 53,856,358 (GRCm39) missense probably benign 0.26
R1968:Cep120 UTSW 18 53,856,313 (GRCm39) missense probably benign 0.42
R1995:Cep120 UTSW 18 53,873,208 (GRCm39) missense probably damaging 1.00
R2042:Cep120 UTSW 18 53,868,814 (GRCm39) missense possibly damaging 0.50
R2074:Cep120 UTSW 18 53,852,384 (GRCm39) missense possibly damaging 0.83
R2116:Cep120 UTSW 18 53,873,208 (GRCm39) missense probably damaging 1.00
R2215:Cep120 UTSW 18 53,860,707 (GRCm39) missense probably damaging 1.00
R2697:Cep120 UTSW 18 53,873,197 (GRCm39) missense probably benign 0.00
R3813:Cep120 UTSW 18 53,873,284 (GRCm39) splice site probably benign
R4012:Cep120 UTSW 18 53,871,654 (GRCm39) missense probably damaging 0.99
R4368:Cep120 UTSW 18 53,818,957 (GRCm39) splice site probably null
R4615:Cep120 UTSW 18 53,847,913 (GRCm39) missense probably damaging 1.00
R4772:Cep120 UTSW 18 53,851,561 (GRCm39) missense probably damaging 1.00
R4780:Cep120 UTSW 18 53,857,608 (GRCm39) missense probably benign 0.12
R5991:Cep120 UTSW 18 53,854,870 (GRCm39) missense probably benign
R6156:Cep120 UTSW 18 53,836,295 (GRCm39) missense probably benign 0.00
R6188:Cep120 UTSW 18 53,857,529 (GRCm39) missense probably benign 0.03
R6688:Cep120 UTSW 18 53,857,608 (GRCm39) missense probably benign 0.12
R6961:Cep120 UTSW 18 53,836,277 (GRCm39) nonsense probably null
R7143:Cep120 UTSW 18 53,816,457 (GRCm39) missense probably benign 0.00
R7282:Cep120 UTSW 18 53,873,161 (GRCm39) missense probably damaging 1.00
R7813:Cep120 UTSW 18 53,871,578 (GRCm39) missense probably damaging 1.00
R7818:Cep120 UTSW 18 53,856,175 (GRCm39) missense probably benign
R8677:Cep120 UTSW 18 53,871,633 (GRCm39) missense possibly damaging 0.90
R8724:Cep120 UTSW 18 53,856,199 (GRCm39) missense possibly damaging 0.88
R9164:Cep120 UTSW 18 53,852,318 (GRCm39) missense probably benign 0.02
R9225:Cep120 UTSW 18 53,839,896 (GRCm39) missense probably benign 0.00
R9300:Cep120 UTSW 18 53,852,369 (GRCm39) missense probably damaging 0.99
R9312:Cep120 UTSW 18 53,860,713 (GRCm39) missense probably benign 0.08
R9377:Cep120 UTSW 18 53,851,592 (GRCm39) missense possibly damaging 0.66
R9390:Cep120 UTSW 18 53,839,984 (GRCm39) nonsense probably null
R9499:Cep120 UTSW 18 53,819,033 (GRCm39) missense possibly damaging 0.94
R9551:Cep120 UTSW 18 53,819,033 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGAGCTACCCTGGATCCAAC -3'
(R):5'- CAGTTCCTGTGTTCATAAAGCAGATC -3'

Sequencing Primer
(F):5'- ACCCTGGATCCAACTTAGTCATTAGG -3'
(R):5'- AGCAGATCTGTCAGACTCTGAGC -3'
Posted On 2016-07-06