Incidental Mutation 'R5196:Lrrfip1'
ID400197
Institutional Source Beutler Lab
Gene Symbol Lrrfip1
Ensembl Gene ENSMUSG00000026305
Gene Nameleucine rich repeat (in FLII) interacting protein 1
SynonymsFliiap1, FLAP (FLI LRR associated protein)
MMRRC Submission 042772-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5196 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location90998737-91128944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91114608 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 245 (E245G)
Ref Sequence ENSEMBL: ENSMUSP00000095254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068116] [ENSMUST00000068167] [ENSMUST00000097649] [ENSMUST00000097650] [ENSMUST00000185531] [ENSMUST00000189617]
Predicted Effect probably benign
Transcript: ENSMUST00000068116
SMART Domains Protein: ENSMUSP00000065850
Gene: ENSMUSG00000026305

DomainStartEndE-ValueType
Pfam:DUF2051 33 354 4.1e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068167
SMART Domains Protein: ENSMUSP00000063878
Gene: ENSMUSG00000026305

DomainStartEndE-ValueType
Pfam:DUF2051 23 123 2.2e-18 PFAM
Pfam:DUF2051 193 387 2.5e-49 PFAM
Pfam:DUF2051 366 553 8.1e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097649
AA Change: E245G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095254
Gene: ENSMUSG00000026305
AA Change: E245G

DomainStartEndE-ValueType
Pfam:DUF2051 23 327 1.3e-87 PFAM
internal_repeat_2 439 528 6e-5 PROSPERO
low complexity region 550 566 N/A INTRINSIC
internal_repeat_2 575 683 6e-5 PROSPERO
internal_repeat_1 647 715 1.05e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000097650
SMART Domains Protein: ENSMUSP00000095255
Gene: ENSMUSG00000026305

DomainStartEndE-ValueType
Pfam:DUF2051 23 120 2.3e-16 PFAM
Pfam:DUF2051 195 368 1.2e-63 PFAM
Pfam:DUF2051 379 554 1.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185531
SMART Domains Protein: ENSMUSP00000139497
Gene: ENSMUSG00000026305

DomainStartEndE-ValueType
Pfam:DUF2051 33 118 1.2e-12 PFAM
low complexity region 138 158 N/A INTRINSIC
Pfam:DUF2051 231 413 3.7e-60 PFAM
Pfam:DUF2051 424 575 1.3e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188708
Predicted Effect probably benign
Transcript: ENSMUST00000189617
SMART Domains Protein: ENSMUSP00000139811
Gene: ENSMUSG00000026305

DomainStartEndE-ValueType
Pfam:DUF2051 23 108 1.4e-12 PFAM
low complexity region 128 148 N/A INTRINSIC
Pfam:DUF2051 229 403 1.2e-60 PFAM
Pfam:DUF2051 414 589 1.8e-44 PFAM
Meta Mutation Damage Score 0.4369 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,796,438 T281A possibly damaging Het
4930503B20Rik A G 3: 146,646,263 probably benign Het
6330409D20Rik T A 2: 32,740,540 probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Amigo2 A G 15: 97,246,061 F160S probably damaging Het
Arcn1 A T 9: 44,760,027 L68M probably damaging Het
Arhgef25 A G 10: 127,185,109 S303P probably damaging Het
Asph A T 4: 9,607,830 S163T probably damaging Het
BC003331 T A 1: 150,382,389 D165V probably damaging Het
Birc6 T C 17: 74,606,141 probably benign Het
Ccm2 G A 11: 6,561,181 probably benign Het
Cdc42bpa T C 1: 180,072,413 V431A probably benign Het
Cdh7 T A 1: 110,138,000 M668K probably damaging Het
Cfap43 A T 19: 47,825,925 W157R probably damaging Het
Chrm5 T C 2: 112,480,384 Y129C probably damaging Het
Chrna5 A G 9: 55,006,519 I421V possibly damaging Het
Clk1 T A 1: 58,414,613 T301S probably benign Het
Col6a3 G T 1: 90,816,538 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam198a T G 9: 121,965,661 S294A probably benign Het
Fbxw19 T C 9: 109,484,428 Y234C probably benign Het
Fgd4 T A 16: 16,484,142 N183I probably benign Het
Fnip2 T C 3: 79,572,538 probably benign Het
Gm9847 T A 12: 14,495,015 noncoding transcript Het
H2-T23 A G 17: 36,032,607 probably null Het
Hdlbp T C 1: 93,420,193 E613G probably damaging Het
Kat6a G A 8: 22,911,713 R366H probably damaging Het
Kctd4 A G 14: 75,962,687 T33A probably benign Het
Klrb1c T A 6: 128,780,299 S268C probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mast3 A T 8: 70,788,245 I220N probably damaging Het
Mfap3 A G 11: 57,529,813 T207A probably damaging Het
Mtdh G T 15: 34,118,004 K75N probably damaging Het
Mybpc1 A G 10: 88,536,351 Y806H probably damaging Het
Ntng1 T C 3: 109,934,983 D158G probably damaging Het
Olfr1176 A G 2: 88,339,748 Y61C possibly damaging Het
Olfr812 T A 10: 129,842,781 D87V possibly damaging Het
Pask A G 1: 93,310,083 probably benign Het
Pif1 G T 9: 65,588,092 A95S probably benign Het
Plppr2 T C 9: 21,941,132 F104S probably damaging Het
Prmt9 G A 8: 77,564,997 V333M probably benign Het
Pten A T 19: 32,815,497 M239L probably benign Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Reg2 T A 6: 78,405,547 L12* probably null Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc5a7 C A 17: 54,281,722 probably null Het
Tcaf3 G T 6: 42,593,715 R368S probably benign Het
Tfcp2 A G 15: 100,520,714 V189A probably damaging Het
Uhrf1bp1 A G 17: 27,856,763 I5V probably benign Het
Wdr12 T C 1: 60,087,084 S191G probably damaging Het
Zfp536 G A 7: 37,480,760 R807W probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Lrrfip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Lrrfip1 APN 1 91068621 missense probably damaging 1.00
IGL00835:Lrrfip1 APN 1 91115418 missense possibly damaging 0.89
IGL01603:Lrrfip1 APN 1 91115913 missense probably benign 0.03
IGL02261:Lrrfip1 APN 1 91112168 missense probably benign 0.22
IGL02401:Lrrfip1 APN 1 91114928 missense probably benign 0.21
IGL02690:Lrrfip1 APN 1 91053661 missense probably damaging 0.97
R0048:Lrrfip1 UTSW 1 91093647 splice site probably benign
R0048:Lrrfip1 UTSW 1 91093647 splice site probably benign
R0891:Lrrfip1 UTSW 1 91068615 missense probably damaging 1.00
R1210:Lrrfip1 UTSW 1 91115193 missense probably benign 0.16
R1352:Lrrfip1 UTSW 1 91115367 missense probably benign
R1488:Lrrfip1 UTSW 1 91114632 missense probably damaging 1.00
R1600:Lrrfip1 UTSW 1 91114667 missense probably damaging 0.98
R1718:Lrrfip1 UTSW 1 91115555 missense probably damaging 0.99
R2056:Lrrfip1 UTSW 1 91115817 missense probably benign 0.25
R2993:Lrrfip1 UTSW 1 91105234 missense probably damaging 0.99
R3782:Lrrfip1 UTSW 1 91112189 missense possibly damaging 0.82
R4191:Lrrfip1 UTSW 1 91110399 missense probably benign 0.39
R4675:Lrrfip1 UTSW 1 91103320 critical splice donor site probably null
R4732:Lrrfip1 UTSW 1 91115647 missense probably benign 0.29
R4733:Lrrfip1 UTSW 1 91115647 missense probably benign 0.29
R5250:Lrrfip1 UTSW 1 91115896 missense possibly damaging 0.90
R5433:Lrrfip1 UTSW 1 91087126 critical splice donor site probably null
R6005:Lrrfip1 UTSW 1 91114611 missense probably damaging 1.00
R6218:Lrrfip1 UTSW 1 91082159 missense probably damaging 0.96
R6600:Lrrfip1 UTSW 1 91115847 missense probably damaging 0.99
R6847:Lrrfip1 UTSW 1 91105128 missense probably damaging 1.00
R6911:Lrrfip1 UTSW 1 91114807 nonsense probably null
R6940:Lrrfip1 UTSW 1 91122413 splice site probably null
R6976:Lrrfip1 UTSW 1 91115015 missense probably benign 0.00
R7002:Lrrfip1 UTSW 1 91115458 missense probably benign 0.31
R7205:Lrrfip1 UTSW 1 91091616 missense probably benign 0.00
R7363:Lrrfip1 UTSW 1 91123120 missense probably benign 0.05
R7552:Lrrfip1 UTSW 1 91105283 missense probably damaging 1.00
R7910:Lrrfip1 UTSW 1 91120152 missense possibly damaging 0.88
R7991:Lrrfip1 UTSW 1 91120152 missense possibly damaging 0.88
R8006:Lrrfip1 UTSW 1 91076951 missense probably damaging 1.00
R8068:Lrrfip1 UTSW 1 91128102 missense probably damaging 1.00
R8086:Lrrfip1 UTSW 1 91115908 missense probably benign 0.00
X0057:Lrrfip1 UTSW 1 91115403 missense possibly damaging 0.67
Z1088:Lrrfip1 UTSW 1 91115530 intron probably benign
Z1176:Lrrfip1 UTSW 1 91101199 missense possibly damaging 0.66
Z1177:Lrrfip1 UTSW 1 91122494 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ATTGCTGCTTTGACACACAG -3'
(R):5'- ACATTTGGCCCCTGCTAGTG -3'

Sequencing Primer
(F):5'- GCTTTGACACACAGGCCCAG -3'
(R):5'- TGCTAGTGGTCCCGGGG -3'
Posted On2016-07-06